View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11652_low_10 (Length: 301)
Name: NF11652_low_10
Description: NF11652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11652_low_10 |
 | |
|
| [»] scaffold0775 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0775 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: scaffold0775
Description:
Target: scaffold0775; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 3 - 139
Target Start/End: Complemental strand, 489 - 350
Alignment:
| Q |
3 |
ttgtatcaggccttgcgcgatgttagggagaggttggcacccgttttgaccggaaggcagcagcaggactagga---gaagtaggactagttgatgtgta |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
489 |
ttgtatcaggccttgcgcgatgttagggagaggttggcacccgttttgaccggaaggcagcagcaggactaggagaagaagtaggactagttgatgtgta |
390 |
T |
|
| Q |
100 |
ggacttgtttttagttttaatgttgagacatgagatagac |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
389 |
ggacttgtttttagttttaatgttgagacatgagatagac |
350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0775; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 193 - 243
Target Start/End: Complemental strand, 296 - 246
Alignment:
| Q |
193 |
acgcatgtggtaactttaagagaaaatgtatcggttgaatctaatatttat |
243 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
296 |
acgcatgtggtaactttaagagataatgtatcggttgaatctaatatttat |
246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University