View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11652_low_18 (Length: 202)
Name: NF11652_low_18
Description: NF11652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11652_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 5 - 181
Target Start/End: Complemental strand, 3673671 - 3673495
Alignment:
| Q |
5 |
cgagtgagatgaagatgaagctgagaagaagtcagacatggtagtggtgagcacaacaaagtggtgttcaaaaacacaatccctgccattgtctctcagc |
104 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3673671 |
cgagtgagaggaagatgaagctgagaagaagtcagacatggtagtggtgagcacaacaaagtggtgttcaaaaacacaatccctgccattgtctctcagc |
3673572 |
T |
 |
| Q |
105 |
ttcttttgtggttctagtttcttcaaaccaatccattcattcctcttcttttcatttcatcactctaatctaactct |
181 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3673571 |
ttcttttgtggttctagtttctccaaaccaatccattcattcctcttcttttcatttcatcactctaatctaactct |
3673495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University