View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11653_high_8 (Length: 446)
Name: NF11653_high_8
Description: NF11653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11653_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 293
Target Start/End: Original strand, 20129522 - 20129808
Alignment:
| Q |
18 |
ggtggtgtggtgcaggtttttcaaatctcaaggcaataaattttattttagttaactctcagcaaagttactgtggtcnnnnnnnatctttgttttagaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
20129522 |
ggtggtgtggtgcaggtttttcaaatctcaaggcaataaattttattttagttaactctcagcaaagttactgtgctctttttttatctttgttttagaa |
20129621 |
T |
 |
| Q |
118 |
aaaagtgattaaactaattcctactctgagtttgagttcaaacaaagaaagcact-cactc----------acagtctcactactattgagaagatatga |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | ||| ||||||||||||||||||||||| |
|
|
| T |
20129622 |
aaaagtgattaaactaattcctactctgagtttgagttcaaacaaagaaagcactgcacacacataaacatacacattcactactattgagaagatatga |
20129721 |
T |
 |
| Q |
207 |
aagaatgcaccaaaacccaatgactcaaacccaagaagaaaagtttggaatttgaggcaaatgttttcattgttttcaatgcttaac |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20129722 |
aagaatgcaccaaaacccaatgactcaaacccaagaagaaaagtttggaatttgaggcaaatgttttcattgttttcaatgcttaac |
20129808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 375 - 442
Target Start/End: Original strand, 20129899 - 20129966
Alignment:
| Q |
375 |
aaccatgaagcctcaactctcttcacatggcttcatacttcatcatcacagcaaccttcatctctctc |
442 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
20129899 |
aaccatgaagcctcaactctcttcacatggcttcatacttcatcatcacagccaccttcatctttctc |
20129966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University