View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11654_high_19 (Length: 354)
Name: NF11654_high_19
Description: NF11654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11654_high_19 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 19 - 354
Target Start/End: Complemental strand, 14984815 - 14984479
Alignment:
| Q |
19 |
cacagagggttgtatgcctaaaggtgaggcaaataaggacaaacgtgctagattacaattcatatacagatggctcacattttctatggatgagtggcag |
118 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14984815 |
cacagggggttgtatgcctaaaggtgaggcaaataaggacaaacatgctagattacaattcatatacagatggctcacattttctatggatgagtggcag |
14984716 |
T |
 |
| Q |
119 |
agagggcatacagtgtctaaatgaataccnnnnnnn-ggagatttgctctagtgggcagaatgtttttagcaagtctccacataaaagttttgatcttgt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14984715 |
agagggcatacagtgtctaaatgaataccttttttttggagatttgctctagtgggcagaatgtttttagcaagtctccacataaaagttttgatcttgt |
14984616 |
T |
 |
| Q |
218 |
ttgggataggagccttccaaacatcattccataatttaccatctctgtcggttgatggacctggacagaggnnnnnnnngttggtgcacaagagatggta |
317 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
14984615 |
ttgggataggagccttccaaatatcattccataatttaccatccctgtcggttgatggacctggacggaggttttctttgttggtgcacaagagatggta |
14984516 |
T |
 |
| Q |
318 |
tgctgaacgtactgctatgggaatgctgacaatcttt |
354 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14984515 |
tgctgaacgtactgatatgggaatgctgacaatcttt |
14984479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 155 - 224
Target Start/End: Original strand, 24553445 - 24553514
Alignment:
| Q |
155 |
ggagatttgctctagtgggcagaatgtttttagcaagtctccacataaaagttttgatcttgtttgggat |
224 |
Q |
| |
|
||||||||| ||||||||||| ||| || |||||||| |||||||| || ||||||| ||||||||||| |
|
|
| T |
24553445 |
ggagatttgatctagtgggcaaaatattcttagcaagcctccacatgaagtttttgattttgtttgggat |
24553514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University