View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11654_high_24 (Length: 317)
Name: NF11654_high_24
Description: NF11654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11654_high_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 304
Target Start/End: Original strand, 25703769 - 25704078
Alignment:
| Q |
1 |
ttgcaatccgtcttgcatcttactctcacgtttttagaaaatatgatattgacataatggtgtagatttagggaagatattggtaacaagtatcattgtc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25703769 |
ttgcaatccgtcttgcatcttactctcacgtttttggaaaatatgatattgacataatggtgtagatttagggaagatattggtaacaagtatcactgtc |
25703868 |
T |
 |
| Q |
101 |
atcacaatcacctttagaatattgtctttatacttcaaaagatcaagacacaaggaaggagtggtaggcgaggactcaaaaagagttataaaatatacat |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25703869 |
atcacaaccacctttagaatattgtctttatacttcaaaagatcaagacacaaggaaggagtggtaggcgaggactcaaaaagagttataaaatatacat |
25703968 |
T |
 |
| Q |
201 |
tataccaatacacctatgaatatgcacccaaatgct------ttatgcacaccctcacaaacagattatctacactttcaaattgaccacagacactcgc |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
25703969 |
tataccaatacacctatgaatatgcacccaaatgctaccataaaatgcacaccctcacaaacagatgatctgcactttcaaattgaccacagacactcgc |
25704068 |
T |
 |
| Q |
295 |
accctgacct |
304 |
Q |
| |
|
|| ||||||| |
|
|
| T |
25704069 |
acactgacct |
25704078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 105 - 152
Target Start/End: Original strand, 7340701 - 7340748
Alignment:
| Q |
105 |
caatcacctttagaatattgtctttatacttcaaaagatcaagacaca |
152 |
Q |
| |
|
||||||||||| | |||||||||| ||||||||||||||||||||||| |
|
|
| T |
7340701 |
caatcacctttcggatattgtcttcatacttcaaaagatcaagacaca |
7340748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 104 - 151
Target Start/End: Complemental strand, 9265858 - 9265811
Alignment:
| Q |
104 |
acaatcacctttagaatattgtctttatacttcaaaagatcaagacac |
151 |
Q |
| |
|
|||||||||||| | ||||| |||||| |||||||||||||||||||| |
|
|
| T |
9265858 |
acaatcacctttggcatattatctttagacttcaaaagatcaagacac |
9265811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University