View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11654_low_21 (Length: 356)
Name: NF11654_low_21
Description: NF11654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11654_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 20 - 349
Target Start/End: Complemental strand, 38267011 - 38266682
Alignment:
| Q |
20 |
attgtaagtaatgtgttgacatcttaggaaatgaactaccatcataaagagtgtgttcaagagtgtattgtcaatcatgaggttaagatttcagtattac |
119 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38267011 |
attgtaagtgatgtgttgacatcttaggaaatgaactaccatcataaagagtgtgttcaagagtgtattgtcaatcatgaggttaagatttcagtattac |
38266912 |
T |
 |
| Q |
120 |
aaagaaggtaactcttgaatttcacacttcaagtcattaaatcaacctttcctcaattcatatatgacaaatgacaactctaaatatttccctctccttc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38266911 |
aaagaaggtaactcttgaatttcacacttcaagtcattaaatcaacctttcctcaattcatatatgacaaatgacaactctaaatatttccctctccttc |
38266812 |
T |
 |
| Q |
220 |
acatatcatgatatgaacaaaagaaatgctgcacataaatgcaaagttggtgtgccatcaatatgcaagcaaccacaccaaactactacaaatttcacat |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38266811 |
acatatcatgatatgaacaaaagaaatgctgcacataaatgcaaagttggtgtgccatcaatatgcaagcaaccacaccaaactactacaaatttcacat |
38266712 |
T |
 |
| Q |
320 |
gcagcataattgtttgtggtcttcatctct |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38266711 |
gcagcataattgtttgtggtcttcatctct |
38266682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University