View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11654_low_28 (Length: 325)
Name: NF11654_low_28
Description: NF11654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11654_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 323
Target Start/End: Complemental strand, 14984489 - 14984182
Alignment:
| Q |
1 |
tgacaatctttaaagcttctgcactgtcaaaatcgtttttccatgttcttactgtacttttttaataccttttatttatttgtcatccggttcaactat- |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14984489 |
tgacaatctttaaagcttctgcactgtcaaaatcgtttttccatgttcttactgtacttttttaataccttttatttatttgtcatccggttcaactata |
14984390 |
T |
 |
| Q |
100 |
--tgaaccccaattttaccatgaccggaagtctcgcaggtttgatattctgtctggttttcaaaacctgtctggttttcaaaacattgcaaaatataaag |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14984389 |
gttgaaccccaattttaccatgaccggaagtctcgcaggtttgatattctgtctggt------------------tttcaaaacattgcaaaatataaag |
14984308 |
T |
 |
| Q |
198 |
gattgattgcagagattcaaattgctgttcacagctgagtcatttctcttttacctagacattggacttttatacgtggtttaagggaaagtggtccttt |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14984307 |
gattgattgcagagattcaaattgctgttcacagctgagtcatttctcttttacctagacattggacttttatacgtggtttgagggaaagtggtccttt |
14984208 |
T |
 |
| Q |
298 |
tgaatttctgataatttaggtctctg |
323 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
14984207 |
tgaatttctgataatttaggtctctg |
14984182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University