View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11654_low_30 (Length: 315)
Name: NF11654_low_30
Description: NF11654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11654_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 12 - 296
Target Start/End: Original strand, 13042148 - 13042433
Alignment:
| Q |
12 |
acagaacatagtggtggatttgaaaacacaaaaagtgtagaaatacaaagtaaacaagggtaatcttgtaaaatggatacttaatttcaaattgtaattt |
111 |
Q |
| |
|
||||||||||| |||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13042148 |
acagaacataggggtggatttggaaacacaacaagtgtagaaatacaaagtaaacaagggtaatcttgtaaaatggatacttaattttaaattgtaattt |
13042247 |
T |
 |
| Q |
112 |
gcaaccataagtttgaataataaaatatccgctagtcgctctaatatcgaaggtgtaggcacgaattgaccgaaatgtgtgatcaatcgtttatgttctt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
13042248 |
gcaaccataagtttgaataataaaatatccgctagtcgctctattatcgaaggcgtaggcacgaattgaccaaaatgtgtgatcgatcgtttatgttctt |
13042347 |
T |
 |
| Q |
212 |
-tgcatattttatttgtattgttttctttagagtcagagtttactattataagaaacctaaatgtagttgatatttcgggtcttga |
296 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
13042348 |
gtgtatattttatttgtattgttttctttagagtcagagtttactattataagaaacctaaatgtggttggtatttcgggtcttga |
13042433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University