View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11654_low_31 (Length: 294)
Name: NF11654_low_31
Description: NF11654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11654_low_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 19 - 284
Target Start/End: Complemental strand, 45426764 - 45426499
Alignment:
| Q |
19 |
gttcctcctggcttgtgagagtccattagactctcaagacttttatttgtgccatccctctcgagccttgccattgcgtagtagagcaatcacttcttat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45426764 |
gttcctcctggcttgtgagagtccattagactctcaagacttttatttgtgccatccctctcgagccttgccattgcgtagtagagcaatcacttcttat |
45426665 |
T |
|
| Q |
119 |
ggcactttgtttgattgctgatgttaagggactttaaagctctaaagttgagttgtgaaaggtataaaaagagaggcaggtgattaaatatggacaaaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45426664 |
ggcactttgtttgattgctgatgttaagggactttaaagcgctaaagttgagttgtgaaaggtataaaaagagaggcaggtgattaaatatggacaaaaa |
45426565 |
T |
|
| Q |
219 |
ggtaatggtcaaaatgaaccaaatcatggcggcaactttggtgaagtccttttccgtttccctttg |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45426564 |
ggtaatggtcaaaatgaaccaaatcatggcggcaactttggtgaagtccttttccgtttccctttg |
45426499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University