View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11654_low_35 (Length: 257)
Name: NF11654_low_35
Description: NF11654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11654_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 159 - 250
Target Start/End: Complemental strand, 19588265 - 19588174
Alignment:
| Q |
159 |
ggtcacacataagttgaaatatcactattattaacataagtactcttaagtagcaatgtttaaatttggatgtaaattggacttctctgctt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19588265 |
ggtcacacataagttgaaatatcactattattaacataagtactcttaagtagcaatgtttaaatttggatgcaaattggacttctctgctt |
19588174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 19588423 - 19588365
Alignment:
| Q |
1 |
aatagttgattcacctgtatatatagaaacacctcaatatataaagaaattcgcatggg |
59 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
19588423 |
aatagttgattcacctgaatatatagaaacacctcaatatataaataatttcgcatggg |
19588365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University