View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11654_low_38 (Length: 249)
Name: NF11654_low_38
Description: NF11654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11654_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 33345634 - 33345396
Alignment:
| Q |
1 |
caagttcgtagaaatatttatagttcgtgatttcttttggtattgaaccagagaaactgttggaatttacgtggaagaatgttaactcttctatttggtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33345634 |
caagttcgtagaaatatttatagttcgtgatttcttttggtattgaaccatagaaactgttggaatttacgtggaagaatgttaactcttctatttggtc |
33345535 |
T |
 |
| Q |
101 |
taagataccttttaagggtatagtgtcacagtttttaccttggaattttttctggttgaagtctaatccagcaactgctcggtcctttgtatttgggaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33345534 |
taagataccttttaagggtatagtgtcacagtttttaccttggaattttttctggttgaagtctaatccagcaactgctcggtcatttgtatttgggaat |
33345435 |
T |
 |
| Q |
201 |
atgccacaaagaattccattgaacttacaagtgtctgtg |
239 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
33345434 |
atgccacaaagaattccatggaagttacaagtgtctgtg |
33345396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University