View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11654_low_47 (Length: 236)
Name: NF11654_low_47
Description: NF11654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11654_low_47 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 143 - 210
Target Start/End: Complemental strand, 4745058 - 4744991
Alignment:
| Q |
143 |
attgtgaaattcgtataaaaatattatatggtgggataagaagcatgtgcagcaatgccacattgacc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4745058 |
attgtgaaattcgtataaaaatattatatgatgggataagaagcatgtgcagcaatgccacattgacc |
4744991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 26 - 69
Target Start/End: Complemental strand, 4745141 - 4745098
Alignment:
| Q |
26 |
atataggcagaatttcaatacaatataagcacgaacacgaagaa |
69 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
4745141 |
atataagcagaatttcagtacaatataagcacgaatacgaagaa |
4745098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University