View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11654_low_49 (Length: 227)
Name: NF11654_low_49
Description: NF11654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11654_low_49 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 197; Significance: 1e-107; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 10 - 214
Target Start/End: Complemental strand, 4367811 - 4367607
Alignment:
| Q |
10 |
agagagaagaaaggccatcttgtggttagttcagcatggtcggcttctcacaaaaagccgggaaatcttatgtgttacgtgattgccacatagccatgaa |
109 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4367811 |
agagagaaggaaggccatcttgtggttagttcagcatggtcggcttctcacaaaaagccgggaaatcttatgtgttacgtgattgccacatagccatgaa |
4367712 |
T |
 |
| Q |
110 |
aatttggattaatatatagttcatgttaacagaagaaatgttttcttttctagaactctccatggctgcattattttgaattttgaaaggaatttgggag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4367711 |
aatttggattaatatatagttcatgttaacagaagaaatgttttcttttctagaactctccatggctgcattattttgaattttgagaggaatttgggag |
4367612 |
T |
 |
| Q |
210 |
ggaat |
214 |
Q |
| |
|
||||| |
|
|
| T |
4367611 |
ggaat |
4367607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 79 - 153
Target Start/End: Complemental strand, 4363255 - 4363181
Alignment:
| Q |
79 |
atgtgttacgtgattgccacatagccatgaaaatttggattaatatatagttcatgttaacagaagaaatgtttt |
153 |
Q |
| |
|
||||||| | |||||||| | |||| |||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4363255 |
atgtgttgcatgattgccccgtagcaatgacaatttggcttaatatatagttcatgttaacagaagaaatgtttt |
4363181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 22 - 80
Target Start/End: Complemental strand, 4363363 - 4363305
Alignment:
| Q |
22 |
ggccatcttgtggttagttcagcatggtcggcttctcacaaaaagccgggaaatcttat |
80 |
Q |
| |
|
|||| |||||||||||||| | |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4363363 |
ggccttcttgtggttagtttaacatggtcggcttctcacaaacagccgggaaatcttat |
4363305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University