View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11655_high_61 (Length: 247)
Name: NF11655_high_61
Description: NF11655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11655_high_61 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 17 - 241
Target Start/End: Complemental strand, 41852778 - 41852554
Alignment:
| Q |
17 |
atatctcattccaatcaatgataaattacacaaaatacagaattttatttacaaacaaaacaatcgagaggatggcaaaactgtcggtgatttttaagac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41852778 |
atatctcattccaatcaatgataaattacacaaaatacagaattttatttacaaacaaaacaatcgagaggatggcaaaactgtcggtgatttttaagac |
41852679 |
T |
 |
| Q |
117 |
aaatatagaaaaccacagccaaaatttggaggcacatctgagtcaatggaacaaattacaataacactggcaatagtaagagcaatgagtccaaatatca |
216 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41852678 |
aaatatagaaaatcacagccaaaatttggaggcacatctgagtcaatggaacaaattacaataacactggcaatagtaagagcaatgagtccaaatatca |
41852579 |
T |
 |
| Q |
217 |
gaccttcatcccaggtttcttctct |
241 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
41852578 |
gaccttcatcccaggtttcttctct |
41852554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University