View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11655_high_63 (Length: 244)
Name: NF11655_high_63
Description: NF11655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11655_high_63 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 66 - 226
Target Start/End: Original strand, 54535343 - 54535503
Alignment:
| Q |
66 |
cgaagtttcaactttcaccaacggatattattacaaaagcgaaaggaaactattgctactgttgttactttttggacttggatgtgattatatttactta |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54535343 |
cgaagtttcaactttcaccaacggatattattacaaaagcgaaaggaaactattgctactgttgttactttttggacttggatgtgattatatttactta |
54535442 |
T |
|
| Q |
166 |
aaatgccactcataattaatcagattcagaatcagtgcccaggtatttagggagctgcatg |
226 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54535443 |
aaatgccactcataaataatcagattcagaatcagtgcccaggtatttagggagctgcatg |
54535503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University