View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11655_high_70 (Length: 239)
Name: NF11655_high_70
Description: NF11655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11655_high_70 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 17004026 - 17004249
Alignment:
| Q |
1 |
ttcacaccattttcttcggggaccctataaatgaggctgtagtttacttggtttgaagccaatggaatacctctcttcttgagctgtttatatgcttcgc |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17004026 |
ttcacaccattttcttcagggaccctataaatgaggctgtagtttacttggtttgaagccaatggaatacctctcttcttgagctgtttatatgcttcgc |
17004125 |
T |
 |
| Q |
101 |
gtagtcggttttctgtataaatagaaaaaaggaatgttaggtacttctgatcatagaactagaacttgttccataaaaagtattatggtacaagttagtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
17004126 |
gtagtcggttttctgtataaatagaaaaaaggaatgttaggtacttctgatcatagaactagaactagttccataaaaagtattatggtacaagttagtc |
17004225 |
T |
 |
| Q |
201 |
atagttttgcataaaattgaagtt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
17004226 |
atagttttgcataaaattgaagtt |
17004249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University