View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11655_high_73 (Length: 230)
Name: NF11655_high_73
Description: NF11655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11655_high_73 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 45281121 - 45280916
Alignment:
| Q |
1 |
cagggatattaggtcggattaacatgtgttgggccggtataaattttataaatttgattttattggttggccatagttagttcgatttaatttaatttac |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45281121 |
cagggatattaggtcgtattaacatgtgttgggccggtata-------taaatttgattttattggttggccatagttagttcgatttaatttaatttac |
45281029 |
T |
 |
| Q |
101 |
aacacaaagctagctagctatagctagtgtggtcttgttgtttgagtgtcatgcgtcataacatagtgaaccacagatcagatctcgcattacgtagtga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45281028 |
aacacaaagctagctagctatagctagtgtggtcttgttgtttgagtgtcatgtgtcataacatagtgaatcacagatcagatctcgcattacgtagtga |
45280929 |
T |
 |
| Q |
201 |
ttgaatttgaaac |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
45280928 |
ttgaatttgaaac |
45280916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University