View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11655_high_74 (Length: 230)
Name: NF11655_high_74
Description: NF11655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11655_high_74 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 39 - 215
Target Start/End: Original strand, 4724205 - 4724380
Alignment:
| Q |
39 |
tcgtcggaatatgtttggtacgtgtttgttcacttttggtgttgacttgagattgggtggcagaagatttgtggccgttttgatgtggttcaatttctat |
138 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
4724205 |
tcgtcggcatatgtttggtacgtgtttgttcacttttggt-ttgacttgagattgggtggcagaagatttgtggccgttttgatgtggttcaatttcaaa |
4724303 |
T |
 |
| Q |
139 |
acccgaaagggtcagtcgatttcaaaaacccgaaagggtcgggtgttactaacgtattggaatcatcccttgatctg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4724304 |
acccgaaagggtcagtcgatttcaaaaacccgaaatggtcgggtgttactaacgtattggaatcatcccttgatctg |
4724380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 50 - 177
Target Start/End: Original strand, 38470460 - 38470589
Alignment:
| Q |
50 |
tgtttggtacgtgtttgttcacttttggtgttgacttgagattgggtggcagaagatttgtggccgttttgatgtggttcaatttc-tatacccgaaagg |
148 |
Q |
| |
|
|||||||||| |||||||| |||||| | ||||| |||||||||||||| |||||||| | |||||||||||||||||||||| | |||||||||| |
|
|
| T |
38470460 |
tgtttggtacatgtttgtttgcttttgttattgaccagagattgggtggcattagatttgtagtcgttttgatgtggttcaatttcaaaaacccgaaagg |
38470559 |
T |
 |
| Q |
149 |
gtcag-tcgatttcaaaaacccgaaagggt |
177 |
Q |
| |
|
||| | ||||||||||||||| ||||||| |
|
|
| T |
38470560 |
gtctgaccgatttcaaaaacccaaaagggt |
38470589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 158 - 207
Target Start/End: Complemental strand, 17459257 - 17459208
Alignment:
| Q |
158 |
tttcaaaaacccgaaagggtcgggtgttactaacgtattggaatcatccc |
207 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||| ||||||| |
|
|
| T |
17459257 |
tttcaaaaacccgaaagggtctgtgattactaacgtattggactcatccc |
17459208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University