View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11655_high_75 (Length: 230)
Name: NF11655_high_75
Description: NF11655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11655_high_75 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 16 - 230
Target Start/End: Complemental strand, 41853105 - 41852891
Alignment:
| Q |
16 |
ctataacaggatacttcagaaagcaacggaattttagaataatgaatcagcaatggtagctaggaatttacaagtgtccttgaagttaatattggaacta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41853105 |
ctataacaggatacttcagaaagcaacggaattttagaataatgaatcagcaatggtagctaggaatttacaagtgtccttgaagttaatattggaacta |
41853006 |
T |
 |
| Q |
116 |
caatttcagcactttttagcagcatttattttcaaataagtagttgctccaaatttgcattggtacaatttgtgtctcacatgtttagtacaagatcgtc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41853005 |
caatttcagcactttttagcagcatttattttcaaataagtagttgctccaaatttgcattggtacaatttgtgtctcacatgtttagtacaagagcgtc |
41852906 |
T |
 |
| Q |
216 |
gaaaattcgcaatga |
230 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
41852905 |
gaaaattcgcaatga |
41852891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University