View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11655_high_81 (Length: 203)
Name: NF11655_high_81
Description: NF11655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11655_high_81 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 15 - 183
Target Start/End: Complemental strand, 48236735 - 48236567
Alignment:
| Q |
15 |
gagatgaaggctaggaaagaggcagaagagaggaataaagtattgaatgcattggctcaaaatgataatcgatatagaaaatacactatgatggagattg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48236735 |
gagatgaaggctaggaaagaggcagaagagaggaataaagtattgaatgcattggctcaaaatgataatcgatatagaaaatacactatgatggagattg |
48236636 |
T |
|
| Q |
115 |
aagttgctaccgagagattctcaccatcaaagaaactaggtgaaggtggatatggacctgtgtttaaag |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48236635 |
aagttgctaccgagagattctcaccatcaaagaaactaggtgaaggtggatacggacctgtgtttaaag |
48236567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 140 - 183
Target Start/End: Original strand, 3685864 - 3685907
Alignment:
| Q |
140 |
atcaaagaaactaggtgaaggtggatatggacctgtgtttaaag |
183 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3685864 |
atcaatgaaaataggtgaaggtggatatggacctgtgtttaaag |
3685907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University