View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11655_low_10 (Length: 603)
Name: NF11655_low_10
Description: NF11655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11655_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 326; Significance: 0; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 22 - 399
Target Start/End: Complemental strand, 40771406 - 40771026
Alignment:
| Q |
22 |
gttgcggttgttgccatgcatgtattattatttagtttggttatgggcttatggataaaaaagattaatttttgtgattttggttattgttttgttaata |
121 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40771406 |
gttgtggttgttgccatgcatgtattattatttagtttggttatgggcttatggataaaaaagattaatttttgtgattttggttattgttttgttaata |
40771307 |
T |
|
| Q |
122 |
gatgcaaagctacctttgtatgcttttaaaaagattgacaaagtaactgaaaaggatttggctatccatgagtgtcaagaggagcttcctatggcctttt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40771306 |
gatgcaaagctacctttgtatgcttttaaaaagattgacaaagtaaccgaaaaggatttggctatccatgagtgtcaagaggagcttcctatggcctttt |
40771207 |
T |
|
| Q |
222 |
tggactcacttgttcttggagaggtgattattgaattttgattatgaagaatgattaaagattttaa---nnnnnnnnnnnatctttttgtttaaaaggt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40771206 |
tggactcacttgttcttggagaggtgattattgaattttgattatgaagaatgattaaagattttaattttaattttttttatctttttgtttaaaaggt |
40771107 |
T |
|
| Q |
319 |
ctattactcttttcatttcagtgggaagatcgcatgcaaagaggactttttcgttatgatgttaccgcctgtgaaaccaag |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40771106 |
ctattactcttttcatttcagtgggaagatcgcatgcaaagaggactttttcgttatgatgttaccgcctgtgaaaccaag |
40771026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 123; E-Value: 7e-63
Query Start/End: Original strand, 463 - 593
Target Start/End: Complemental strand, 40770962 - 40770832
Alignment:
| Q |
463 |
gagatgcatgaatatactttgattctttgttatttggggggattttgtgtatttgtattgtgccttttgcagatgcatggatatactttgattctttttt |
562 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40770962 |
gagatgcatgaatatactttgattctttgttatttggggggattttgtgtacttgtattgtgccttttgcagatgcatggatatactttgattctttttt |
40770863 |
T |
|
| Q |
563 |
attacttactgtgattctttgattctgatgt |
593 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |
|
|
| T |
40770862 |
attacttactgtgattctttgattcttatgt |
40770832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 476 - 565
Target Start/End: Complemental strand, 40771020 - 40770929
Alignment:
| Q |
476 |
atactttgattctttgttatttg--gggggattttgtgtatttgtattgtgccttttgcagatgcatggatatactttgattcttttttatt |
565 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||| ||||| |||||| ||||| ||||||||| ||||||||||||||||| ||||| |
|
|
| T |
40771020 |
atactttgattctttgttcttttttgggggattttgtgtgtttgtgttgtgctttttggagatgcatgaatatactttgattctttgttatt |
40770929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 338 - 399
Target Start/End: Complemental strand, 21012859 - 21012798
Alignment:
| Q |
338 |
agtgggaagatcgcatgcaaagaggactttttcgttatgatgttaccgcctgtgaaaccaag |
399 |
Q |
| |
|
||||||| ||||||||||| ||||| | || ||||| |||||||| ||||||||||||||| |
|
|
| T |
21012859 |
agtgggaggatcgcatgcagagagggttgttccgttacgatgttactgcctgtgaaaccaag |
21012798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University