View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11655_low_30 (Length: 392)
Name: NF11655_low_30
Description: NF11655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11655_low_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 155 - 381
Target Start/End: Complemental strand, 30965534 - 30965308
Alignment:
| Q |
155 |
attgcctctctaatttttctttcatcccttttctccttcatcctcaagcgctgctcacggccctctccaaagtaaaattgatacattctatgaacattat |
254 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30965534 |
attgtctctctaatttttctttcatcccttttctccttcatcctcaagcgctgctcacggccctctccaaagtaaaattgatacattctatgaacattat |
30965435 |
T |
 |
| Q |
255 |
aaaatgtttgaattatctccacaatgatatggataataatgatgacaaaaaccacataagaaccatatttaatcttttctattagatagaccactgaatc |
354 |
Q |
| |
|
||||||||||||||||| |||||||| | | ||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30965434 |
aaaatgtttgaattatccccacaatggttttgataataatgatgacaaaaactacataaaaaccatatttaatcttttctattagatagagcactgaatc |
30965335 |
T |
 |
| Q |
355 |
atgaccagtagtaagtccaaggttctt |
381 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
30965334 |
atgaccagtagtaagtccaaggttctt |
30965308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University