View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11655_low_34 (Length: 372)
Name: NF11655_low_34
Description: NF11655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11655_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 22 - 330
Target Start/End: Complemental strand, 43409219 - 43408911
Alignment:
| Q |
22 |
cagcagcgtgtaagccaaacatgttggcatggtgagcaagtggatattcagatttgctgaaggcagtaatatcaatagcaaaacaaggtttggttgttgt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43409219 |
cagcagcgtgtaagccaaacatgttggcatggtgagcaagtggatattcagatttgctgaaggcagtaatatcaatagcaaaacaaggtttggttgttgt |
43409120 |
T |
 |
| Q |
122 |
gaaggctgttcctactattccttgtccattaaaaaggtgatactcactgcacgcttcttggaatcccaatacatccatgtcaccaacataacaagctgaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43409119 |
gaaggctgttcctactattccttgtccattaaaaaggtgatactcactgcacgcttcttggaatcccaatacatccatgtcaccaacataacaagctgaa |
43409020 |
T |
 |
| Q |
222 |
tcaaccgttgatatgcagcaactcatagttgaaacaccacaacctgatgcaccactacttccctttcctcctccttgttgttgttgtaggcaaggagccc |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43409019 |
tcaaccgttgatatgcagcaactcatagttgaaacaccacaacctgatgcaccactacttccctttcctcctccttgttgttgttgtaggcaaggagccc |
43408920 |
T |
 |
| Q |
322 |
atgttagtg |
330 |
Q |
| |
|
||||||||| |
|
|
| T |
43408919 |
atgttagtg |
43408911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University