View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11655_low_38 (Length: 356)
Name: NF11655_low_38
Description: NF11655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11655_low_38 |
 |  |
|
| [»] chr1 (74 HSPs) |
 |  |
|
| [»] chr4 (78 HSPs) |
 |  |
|
| [»] chr5 (53 HSPs) |
 |  |
|
| [»] chr2 (66 HSPs) |
 |  |
|
| [»] chr7 (61 HSPs) |
 |  |
|
| [»] chr3 (57 HSPs) |
 |  |
|
| [»] scaffold0026 (1 HSPs) |
 |  |
|
| [»] chr6 (43 HSPs) |
 |  |
|
| [»] scaffold0040 (1 HSPs) |
 |  |  |
|
| [»] scaffold1619 (1 HSPs) |
 |  |
|
| [»] scaffold0066 (1 HSPs) |
 |  |
|
| [»] scaffold1127 (1 HSPs) |
 |  |
|
| [»] scaffold0154 (1 HSPs) |
 |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |
|
| [»] scaffold0238 (1 HSPs) |
 |  |
|
| [»] scaffold0143 (1 HSPs) |
 |  |
|
| [»] scaffold0038 (1 HSPs) |
 |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |
|
| [»] scaffold0524 (1 HSPs) |
 |  |
|
| [»] scaffold0044 (1 HSPs) |
 |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 2e-86; HSPs: 74)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 163 - 356
Target Start/End: Complemental strand, 5908018 - 5907825
Alignment:
| Q |
163 |
tatatgttatgcctttcatatgatatagagacattcatgtgaagagcttttcatgtagattatttatctttgaatagttgaactttgattcaataaaatt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5908018 |
tatatgttatgcctttcatatgatatagagacattcatgtgaagagcttttcatgtagattatttatctttgaatagttgaactttgattcaataaaatt |
5907919 |
T |
 |
| Q |
263 |
ttgttttgggtaaagaaatgtaatgattaatgacatacgnnnnnnnnggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
5907918 |
ttgttttgggtaaagaaatgtaatgattaatgacatacgttttttttggtggtgtccggggtttgaaccctggaccttgcatatattatgcatt |
5907825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 5908179 - 5908075
Alignment:
| Q |
1 |
ggagaagatctagtaacatgggatcacttgattatcaatggaaggttaaagtcattgatcctagaaattctgactctcatttgatggattaaatgcttat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5908179 |
ggagaagatctagtaacatgggatcacttgattatcaatggaaggttaaagtcattgatcctagaaattctgactctcatttgatggattaaatgtttat |
5908080 |
T |
 |
| Q |
101 |
acaac |
105 |
Q |
| |
|
||||| |
|
|
| T |
5908079 |
acaac |
5908075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 5912059 - 5911952
Alignment:
| Q |
1 |
ggagaagatctagtaacatgggatcacttgattatcaatggaaggttaaagtcattgatcctagaaattctgactctcatttgatggattaaatgcttat |
100 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||| |||| | |||| |||| ||||||||||| |||| |||| |||||||||||| || |||| |
|
|
| T |
5912059 |
ggagaagatctaataagatgggatcacttgattatcattggaggattaatgtcacagatcctagaaaatctggatctcttttgatggattagattattat |
5911960 |
T |
 |
| Q |
101 |
acaacttc |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
5911959 |
acaacttc |
5911952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 38448855 - 38448901
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38448855 |
ggtggtgtccgggattcgaaccccggaccttgcatatattatgcatt |
38448901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 6000133 - 6000178
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
6000133 |
gtggtgtccggggtttgaacctcggaccttgcatatattatgcatt |
6000178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 3481633 - 3481587
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
3481633 |
ggtggtggccggggtttgaaccccagaccttgcatatattatgcatt |
3481587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 314 - 356
Target Start/End: Complemental strand, 11681291 - 11681249
Alignment:
| Q |
314 |
gtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
11681291 |
gtgtccggggtttgaaccccagaccttgcatatattatgcatt |
11681249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 310 - 352
Target Start/End: Complemental strand, 19620648 - 19620606
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19620648 |
ggtggtgtccaagatttgaaccccggaccttgcatatattatg |
19620606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 21638185 - 21638139
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||| ||||||| |
|
|
| T |
21638185 |
ggtggtgtccggggttcgaaccccggaccttgcatatatcatgcatt |
21638139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 318 - 356
Target Start/End: Complemental strand, 25533037 - 25532999
Alignment:
| Q |
318 |
ccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25533037 |
ccggggtttgaaccccggaccttgcatatattatgcatt |
25532999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 34521179 - 34521225
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
34521179 |
ggtggtggccgaggtttgaaccccggaccttgcatatattatgcatt |
34521225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 50638905 - 50638951
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| |||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
50638905 |
ggtggtggccgggattcgaaccctggaccttgcatatattatgcatt |
50638951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 127145 - 127100
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
127145 |
gtggtggccgggatttaaaccccggaccttgcatatataatgcatt |
127100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 8736506 - 8736461
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
8736506 |
gtggtggccggggtttgaaccccggaccttgcatattttatgcatt |
8736461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 319 - 356
Target Start/End: Original strand, 12268982 - 12269019
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12268982 |
cggggtttgaaccccggaccttgcatatattatgcatt |
12269019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 319 - 356
Target Start/End: Complemental strand, 32561036 - 32560999
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32561036 |
cgggatttgaaccccggaccttgcatatattatacatt |
32560999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 34595943 - 34595898
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
34595943 |
gtggtggccgaggtttgaaccccggaccttgcatatattatgcatt |
34595898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 41973326 - 41973281
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
41973326 |
gtggtggccggggttcgaaccccggaccttgcatatattatgcatt |
41973281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 44641598 - 44641553
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| || ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44641598 |
gtggtggccaggatttgaaccccgggccttgcatatattatgcatt |
44641553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 44678007 - 44678052
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44678007 |
gtggtgaccaggatttgaaccccgaaccttgcatatattatgcatt |
44678052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 49431983 - 49432028
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
49431983 |
gtggtggccggggtttgaaccccggaccttacatatattatgcatt |
49432028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 321 - 356
Target Start/End: Complemental strand, 22346737 - 22346702
Alignment:
| Q |
321 |
ggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22346737 |
ggatttgaaccccggaccttgcatattttatgcatt |
22346702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 310 - 349
Target Start/End: Original strand, 23730368 - 23730407
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatatt |
349 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
23730368 |
ggtggtgtccggggttcgaaccccggaccttgcatatatt |
23730407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 326 - 356
Target Start/End: Original strand, 4968620 - 4968650
Alignment:
| Q |
326 |
tgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4968620 |
tgaaccccggaccttgcatatattatgcatt |
4968650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 321 - 355
Target Start/End: Original strand, 7610169 - 7610203
Alignment:
| Q |
321 |
ggatttgaaccccggaccttgcatatattatgcat |
355 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7610169 |
ggatttgaaccccagaccttgcatatattatgcat |
7610203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 9413870 - 9413824
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||| |||||||||| |||||||| ||||| ||||||||||||||| |
|
|
| T |
9413870 |
ggtggcgtccgggattcgaaccccgaaccttacatatattatgcatt |
9413824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 318 - 356
Target Start/End: Complemental strand, 14880892 - 14880854
Alignment:
| Q |
318 |
ccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
14880892 |
ccgggatttgaacctcagaccttgcatatattatgcatt |
14880854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 17139506 - 17139552
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
17139506 |
ggtggtggtcggggtttgaaccccggaccttgaatatattatgcatt |
17139552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 312 - 350
Target Start/End: Original strand, 19795107 - 19795145
Alignment:
| Q |
312 |
tggtgtccgggatttgaaccccggaccttgcatatatta |
350 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
19795107 |
tggtggccggggtttgaaccccggaccttgcatatatta |
19795145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 23405347 - 23405393
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
23405347 |
ggtggtggtcgggattcgaaccctggaccttgcatatattatgcatt |
23405393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 27533315 - 27533269
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
27533315 |
ggtggtggtcggggtttgaaccccgaaccttgcatatattatgcatt |
27533269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 35474024 - 35473978
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||| || |||||| | ||||||||||||||||||||| |
|
|
| T |
35474024 |
ggtggtgtccggggttcgaaccctgaaccttgcatatattatgcatt |
35473978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 37045135 - 37045181
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||| ||| || |||||| ||||||||||||||||||||||| |
|
|
| T |
37045135 |
ggtggtgtctggggttcgaaccctggaccttgcatatattatgcatt |
37045181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 322 - 356
Target Start/End: Complemental strand, 40613083 - 40613049
Alignment:
| Q |
322 |
gatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
40613083 |
gattcgaaccccggaccttgcatatattatgcatt |
40613049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 318 - 356
Target Start/End: Original strand, 41763152 - 41763190
Alignment:
| Q |
318 |
ccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
41763152 |
ccggggtttgaaccccggaccttgcatattttatgcatt |
41763190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 42045361 - 42045407
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||| ||||||| || |||||||||||||||||||||| |
|
|
| T |
42045361 |
ggtggtggccggggtttgaactccagaccttgcatatattatgcatt |
42045407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 46392305 - 46392259
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
46392305 |
ggtggtggtcggaatttgaaccccggaccttggatatattatgcatt |
46392259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 352
Target Start/End: Original strand, 47071947 - 47071989
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatg |
352 |
Q |
| |
|
|||| ||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
47071947 |
ggtgttgtccaggatttgaatcccggaccttgcatatattatg |
47071989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 47528436 - 47528482
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||| || ||||| |||||||||| ||||||||||||| |
|
|
| T |
47528436 |
ggtggtgtccggggttcgaacctcggaccttgcgtatattatgcatt |
47528482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 47719096 - 47719142
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| |||||||| |||| ||| ||||||||||||||||||||| |
|
|
| T |
47719096 |
ggtggtggccgggattcgaactccgaaccttgcatatattatgcatt |
47719142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Complemental strand, 2994821 - 2994784
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
2994821 |
cggggtttgaaccccggaccttgcatatattatacatt |
2994784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Complemental strand, 4302515 - 4302478
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
4302515 |
cgggatttgaactccggatcttgcatatattatgcatt |
4302478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 348
Target Start/End: Original strand, 6423751 - 6423788
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatat |
348 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
6423751 |
gtggtggccggggtttgaaccccggaccttgcatatat |
6423788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 352
Target Start/End: Original strand, 8269366 - 8269399
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatg |
352 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
8269366 |
cggggtttgaaccccggaccttgcatatattatg |
8269399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 9639807 - 9639852
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||| | || |||| ||||||||||||||||||||||||| |
|
|
| T |
9639807 |
gtggtgtccgaggttcgaactccggaccttgcatatattatgcatt |
9639852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Complemental strand, 12212358 - 12212321
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
12212358 |
cggggtttgaaccccggacgttgcatatattatgcatt |
12212321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 16033440 - 16033485
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
16033440 |
gtggtggccggagtttgaaccccagaccttgcatatattatgcatt |
16033485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 17284022 - 17283977
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||| || || |||||| ||||||||||||||||||||||| |
|
|
| T |
17284022 |
gtggtgtccagggttcgaaccctggaccttgcatatattatgcatt |
17283977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Complemental strand, 18166665 - 18166628
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
18166665 |
cggggtttgaaccccggactttgcatatattatgcatt |
18166628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Original strand, 28832169 - 28832206
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
28832169 |
cgggatttgaacctcagaccttgcatatattatgcatt |
28832206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Complemental strand, 29042600 - 29042563
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
29042600 |
cgggatttgaaccccggatcttacatatattatgcatt |
29042563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 323 - 356
Target Start/End: Complemental strand, 30521926 - 30521893
Alignment:
| Q |
323 |
atttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
30521926 |
atttgaatcccggaccttgcatatattatgcatt |
30521893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 33153870 - 33153915
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| |||| |||||||| |||||||| ||||||||||||||| |
|
|
| T |
33153870 |
gtggtgttcggggtttgaacctcggaccttacatatattatgcatt |
33153915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 34632240 - 34632195
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| |||||||||||||| |||| |||||||||||||| |||| |
|
|
| T |
34632240 |
gtggtggccgggatttgaacctcggatcttgcatatattatacatt |
34632195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 327 - 356
Target Start/End: Complemental strand, 45481548 - 45481519
Alignment:
| Q |
327 |
gaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
45481548 |
gaaccccggaccttgcatatattatgcatt |
45481519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 1605454 - 1605422
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
1605454 |
tttgaaccccggaccttgcatattttatgcatt |
1605422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 1794654 - 1794622
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
1794654 |
tttgaaccccggatcttgcatatattatgcatt |
1794622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 2596943 - 2596975
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
2596943 |
tttgaaccccggaccttgcatattttatgcatt |
2596975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 352
Target Start/End: Original strand, 3937525 - 3937553
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatg |
352 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3937525 |
tttgaaccccggaccttgcatatattatg |
3937553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 10356717 - 10356749
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
10356717 |
tttgaaccccagaccttgcatatattatgcatt |
10356749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 10654450 - 10654482
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
10654450 |
tttgaaccacggaccttgcatatattatgcatt |
10654482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 15668556 - 15668524
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
15668556 |
tttgaaccccggaccttgcatattttatgcatt |
15668524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 312 - 356
Target Start/End: Complemental strand, 22335428 - 22335384
Alignment:
| Q |
312 |
tggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| |||| |||||||| | |||||||||||||||||||||| |
|
|
| T |
22335428 |
tggtgttcggggtttgaacctcagaccttgcatatattatgcatt |
22335384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 310 - 354
Target Start/End: Complemental strand, 24529757 - 24529713
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgca |
354 |
Q |
| |
|
||||||| |||||||| |||||||||||||| ||||| ||||||| |
|
|
| T |
24529757 |
ggtggtggccgggattcgaaccccggaccttacatattttatgca |
24529713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 26755674 - 26755642
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
26755674 |
tttgaaccccggaccttgcatatataatgcatt |
26755642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 26803454 - 26803486
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
26803454 |
tttgaaccccggactttgcatatattatgcatt |
26803486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 29739395 - 29739363
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
29739395 |
tttgaaccccggaccttgcatattttatgcatt |
29739363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 32950764 - 32950796
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
32950764 |
tttgaactccggaccttgcatatattatgcatt |
32950796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 36679648 - 36679616
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
36679648 |
tttgaaccccggaccttgcatatattatccatt |
36679616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 352
Target Start/End: Original strand, 39252149 - 39252177
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatg |
352 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39252149 |
tttgaaccccggaccttgcatatattatg |
39252177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 41769818 - 41769850
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
41769818 |
tttgaaccccggaccttggatatattatgcatt |
41769850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 45003458 - 45003426
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
45003458 |
tttgaaccccggaccttgcatatattatccatt |
45003426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 46707930 - 46707898
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
46707930 |
tttgaaccccggaacttgcatatattatgcatt |
46707898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 49222874 - 49222842
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
49222874 |
tttgaaccccggaccttgcatatattgtgcatt |
49222842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 78)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 54294411 - 54294457
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
54294411 |
ggtggtgtccggggtttgaaccccggaccttgcatatattatgcatt |
54294457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 49041971 - 49042016
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
49041971 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcatt |
49042016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 311 - 353
Target Start/End: Complemental strand, 11198399 - 11198357
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgc |
353 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11198399 |
gtggtggccggggtttgaaccccggaccttgcatatattatgc |
11198357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 20799383 - 20799429
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| || || ||||||||||||||||||||||||||||||||| |
|
|
| T |
20799383 |
ggtggtgaccagggtttgaaccccggaccttgcatatattatgcatt |
20799429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 54857604 - 54857650
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
54857604 |
ggtggtggccggggtttgaaccccggaccttgcatattttatgcatt |
54857650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 56497597 - 56497643
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| |||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
56497597 |
ggtggtggccgggattcgaaccccagaccttgcatatattatgcatt |
56497643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 3936698 - 3936653
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
3936698 |
gtggtggccggggttcgaaccccggaccttgcatatattatgcatt |
3936653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 7230351 - 7230306
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
7230351 |
gtggtggccgaggtttgaaccccggaccttgcatatattatgcatt |
7230306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 319 - 356
Target Start/End: Original strand, 11949761 - 11949798
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11949761 |
cggggtttgaaccccggaccttgcatatattatgcatt |
11949798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 319 - 356
Target Start/End: Original strand, 19479475 - 19479512
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
19479475 |
cggggtttgaaccccggaccttgcatatattatgcatt |
19479512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 25978388 - 25978343
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||| |||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
25978388 |
gtggtgtctgggattcgaacctcggaccttgcatatattatgcatt |
25978343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 319 - 356
Target Start/End: Complemental strand, 44816004 - 44815967
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44816004 |
cggggtttgaaccccggaccttgcatatattatgcatt |
44815967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 56551582 - 56551627
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
56551582 |
gtggtggccggggtttgaacctcggaccttgcatatattatgcatt |
56551627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 312 - 356
Target Start/End: Complemental strand, 281661 - 281617
Alignment:
| Q |
312 |
tggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||| | ||||||||||||||||| ||||||||||||||| |
|
|
| T |
281661 |
tggtgtccgaggtttgaaccccggacctttcatatattatgcatt |
281617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 675976 - 675944
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
675976 |
tttgaaccccggaccttgcatatattatgcatt |
675944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 312 - 352
Target Start/End: Original strand, 7371539 - 7371579
Alignment:
| Q |
312 |
tggtgtccgggatttgaaccccggaccttgcatatattatg |
352 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
7371539 |
tggtgtccggggttcgaaccccggaccttgcatatattatg |
7371579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 320 - 356
Target Start/End: Complemental strand, 16737133 - 16737097
Alignment:
| Q |
320 |
gggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16737133 |
gggatttgaacccccgaccttgcatatattatgcatt |
16737097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 17423180 - 17423212
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
17423180 |
tttgaaccccggaccttgcatatattatgcatt |
17423212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 312 - 352
Target Start/End: Complemental strand, 19314237 - 19314197
Alignment:
| Q |
312 |
tggtgtccgggatttgaaccccggaccttgcatatattatg |
352 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
19314237 |
tggtgtccggggtttgagccccggaccttgcatatattatg |
19314197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 20383546 - 20383514
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
20383546 |
tttgaaccccggaccttgcatatattatgcatt |
20383514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 25783452 - 25783484
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
25783452 |
tttgaaccccggaccttgcatatattatgcatt |
25783484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 49953406 - 49953438
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
49953406 |
tttgaaccccggaccttgcatatattatgcatt |
49953438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 311 - 354
Target Start/End: Original strand, 42316814 - 42316857
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgca |
354 |
Q |
| |
|
|||||| |||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
42316814 |
gtggtgaccgggattcgaacctcggaccttgcatatattatgca |
42316857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 313 - 356
Target Start/End: Original strand, 49952663 - 49952706
Alignment:
| Q |
313 |
ggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| |||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
49952663 |
ggtggccgggatttgaaccactgaccttgcatatattatgcatt |
49952706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 2034084 - 2034130
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||| |||||||||||| |||||| |||||||||||||| |
|
|
| T |
2034084 |
ggtggtgtccgagatttgaaccccagaccttaaatatattatgcatt |
2034130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 3580786 - 3580740
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||| || ||| ||| |||||||||||||||||||||| |
|
|
| T |
3580786 |
ggtggtgtccggggttcgaatcccagaccttgcatatattatgcatt |
3580740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 9946499 - 9946453
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
9946499 |
ggtggtggtcggggtttgaaccccggaccttgcatattttatgcatt |
9946453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 11144654 - 11144700
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||| || |||||| |||||||||||||||||||||| |
|
|
| T |
11144654 |
ggtggtgtccggggttcaaaccccagaccttgcatatattatgcatt |
11144700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 348
Target Start/End: Original strand, 11314646 - 11314684
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatat |
348 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
11314646 |
ggtggtgtccggggtttgaacctcggaccttgcatatat |
11314684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 28435237 - 28435283
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| | ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
28435237 |
ggtggtggctggggtttgaaccccgaaccttgcatatattatgcatt |
28435283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 311 - 349
Target Start/End: Complemental strand, 32139411 - 32139373
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatatt |
349 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
32139411 |
gtggtgtccggggttcgaaccccggaccttgcatatatt |
32139373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 34833995 - 34834041
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||| | || |||||||||||||||||||||||||||||| |
|
|
| T |
34833995 |
ggtggtgtccagtgttcgaaccccggaccttgcatatattatgcatt |
34834041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 318 - 356
Target Start/End: Complemental strand, 37921810 - 37921772
Alignment:
| Q |
318 |
ccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
37921810 |
ccggggtttgaatcccggaccttgcatatattatgcatt |
37921772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 43034331 - 43034377
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||| |||||||| | |||||||||||||||||||||| |
|
|
| T |
43034331 |
ggtggtggccggggtttgaacctcagaccttgcatatattatgcatt |
43034377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 46676487 - 46676533
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||| ||| | |||||||||||||||||||||||||||||| |
|
|
| T |
46676487 |
ggtggtgtctgggggtcgaaccccggaccttgcatatattatgcatt |
46676533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 47806245 - 47806291
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||| |||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
47806245 |
ggtggtgttcggggttcgaaccccagaccttgcatatattatgcatt |
47806291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 318 - 352
Target Start/End: Original strand, 47814248 - 47814282
Alignment:
| Q |
318 |
ccgggatttgaaccccggaccttgcatatattatg |
352 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47814248 |
ccggggtttgaaccccggaccttgcatatattatg |
47814282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 318 - 356
Target Start/End: Original strand, 48226495 - 48226533
Alignment:
| Q |
318 |
ccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
48226495 |
ccgggatttgaaccccagaccttgcatattttatgcatt |
48226533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 55061109 - 55061063
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
55061109 |
ggtggtggtcggaatttgaacccccgaccttgcatatattatgcatt |
55061063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 2888945 - 2888900
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| |||||||| ||||||||||||||||||| |||| |
|
|
| T |
2888945 |
gtggtggccggggtttgaaccgcggaccttgcatatattatacatt |
2888900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 8495058 - 8495013
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||||||||||| | ||| ||||||||||||||||||| |
|
|
| T |
8495058 |
gtggtggccgggatttgaactcgggatcttgcatatattatgcatt |
8495013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 10006411 - 10006366
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| |||| ||| ||||||| |||||||||||||||||||||| |
|
|
| T |
10006411 |
gtggtggccggtattcgaaccccagaccttgcatatattatgcatt |
10006366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 352
Target Start/End: Complemental strand, 10035336 - 10035295
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatg |
352 |
Q |
| |
|
|||||| ||||| |||||||||| |||||||||||||||||| |
|
|
| T |
10035336 |
gtggtggccggggtttgaaccccagaccttgcatatattatg |
10035295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 10261759 - 10261804
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||| ||||||||||||||| ||||||||| |
|
|
| T |
10261759 |
gtggtggccggggtttgaactccggaccttgcatattttatgcatt |
10261804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Original strand, 14202477 - 14202514
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
14202477 |
cggggtttgaaccccggaccttacatatattatgcatt |
14202514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 19588225 - 19588180
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||||| ||||||||||||| ||||||||| |
|
|
| T |
19588225 |
gtggtggccggggtttgaaccctggaccttgcatattttatgcatt |
19588180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 19854636 - 19854591
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||| | || |||||||||| ||||||||||||||||||| |
|
|
| T |
19854636 |
gtggtgtccgaggttcgaaccccggatcttgcatatattatgcatt |
19854591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Original strand, 21114303 - 21114340
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
21114303 |
cggggtttgaaccccggaccttgcatatatcatgcatt |
21114340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 21562696 - 21562651
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||| ||||||||||||||| ||||||||| |
|
|
| T |
21562696 |
gtggtggccggggtttgaactccggaccttgcatattttatgcatt |
21562651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 327 - 356
Target Start/End: Original strand, 24664997 - 24665026
Alignment:
| Q |
327 |
gaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
24664997 |
gaaccccggaccttgcatatattatgcatt |
24665026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 26926700 - 26926745
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||| ||||||||||||||| ||||||||| |
|
|
| T |
26926700 |
gtggtggccggggtttgaactccggaccttgcatattttatgcatt |
26926745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 35287497 - 35287542
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| || |||||||||||||||||||| ||||||||| |
|
|
| T |
35287497 |
gtggtggccggggttggaaccccggaccttgcatattttatgcatt |
35287542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Complemental strand, 36490631 - 36490594
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
36490631 |
cgggatttgaaccccggatcttgcatacattatgcatt |
36490594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 38375028 - 38374983
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||| || |||||||||||||||||||||| |
|
|
| T |
38375028 |
gtggtggccggggtttgaactccagaccttgcatatattatgcatt |
38374983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 39974573 - 39974528
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||| | |||||||||| |||||| ||||||||||||||| |
|
|
| T |
39974573 |
gtggtgtccgaggtttgaaccccagaccttccatatattatgcatt |
39974528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 43330217 - 43330172
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||| ||||||||||||||| ||||||||| |
|
|
| T |
43330217 |
gtggtggccggggtttgaactccggaccttgcatattttatgcatt |
43330172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 48283317 - 48283362
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||| ||||||||||||| || ||||||||||||||||||| |
|
|
| T |
48283317 |
gtggtgtctgggatttgaaccctagaacttgcatatattatgcatt |
48283362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 327 - 356
Target Start/End: Complemental strand, 49473700 - 49473671
Alignment:
| Q |
327 |
gaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
49473700 |
gaaccccggaccttgcatatattatgcatt |
49473671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 318 - 355
Target Start/End: Original strand, 50152235 - 50152272
Alignment:
| Q |
318 |
ccgggatttgaaccccggaccttgcatatattatgcat |
355 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
50152235 |
ccggggtttgaaccccgaaccttgcatatattatgcat |
50152272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 51450283 - 51450238
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||| ||||||||||||||| ||||||||| |
|
|
| T |
51450283 |
gtggtggccggggtttgaactccggaccttgcatatcttatgcatt |
51450238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Complemental strand, 53190358 - 53190321
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
53190358 |
cgggattcgaaccctggaccttgcatatattatgcatt |
53190321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 6087805 - 6087773
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
6087805 |
tttgaaccccagaccttgcatatattatgcatt |
6087773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 12322731 - 12322699
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
12322731 |
tttgaaccccggaacttgcatatattatgcatt |
12322699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 16304101 - 16304133
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
16304101 |
tttgaatcccggaccttgcatatattatgcatt |
16304133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 21317341 - 21317373
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
21317341 |
tttgaacccctgaccttgcatatattatgcatt |
21317373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 22040708 - 22040676
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
22040708 |
tttgaaccccgaaccttgcatatattatgcatt |
22040676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 29908114 - 29908082
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
29908114 |
tttgaactccggaccttgcatatattatgcatt |
29908082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 34042298 - 34042266
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
34042298 |
tttgaaccccgaaccttgcatatattatgcatt |
34042266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 36035892 - 36035860
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
36035892 |
tttgaaccccggaccttggatatattatgcatt |
36035860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 37193307 - 37193275
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
37193307 |
tttgaaccccggaccttgcatatattatacatt |
37193275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 328 - 356
Target Start/End: Complemental strand, 42845079 - 42845051
Alignment:
| Q |
328 |
aaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42845079 |
aaccccggaccttgcatatattatgcatt |
42845051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 312 - 356
Target Start/End: Complemental strand, 43027362 - 43027318
Alignment:
| Q |
312 |
tggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||| ||||| | ||||||||||||||||||||| |
|
|
| T |
43027362 |
tggtgtccgggattcgaaccatgaaccttgcatatattatgcatt |
43027318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 43722823 - 43722791
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
43722823 |
tttgaaccccggaccttacatatattatgcatt |
43722791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 48226750 - 48226718
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
48226750 |
tttgaaccccggaccttgcatattttatgcatt |
48226718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 49952572 - 49952604
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
49952572 |
tttgaaccccggaccttacatatattatgcatt |
49952604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 50362142 - 50362174
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
50362142 |
tttgaaccctggaccttgcatatattatgcatt |
50362174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 311 - 351
Target Start/End: Original strand, 51298686 - 51298726
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattat |
351 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
51298686 |
gtggtgtccgggattcaaaccccgaaccttgcatatattat |
51298726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 54500627 - 54500595
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
54500627 |
tttgaaccccggaccttacatatattatgcatt |
54500595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 55)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 310 - 355
Target Start/End: Original strand, 30176408 - 30176453
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcat |
355 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30176408 |
ggtggtgtccggggtttgaaccccggaccttgcatatattatgcat |
30176453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 12748973 - 12748927
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12748973 |
ggtggtggccggggtttgaaccccggaccttgcatatattatgcatt |
12748927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 32051521 - 32051567
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32051521 |
ggtggtggccggggtttgaaccccggaccttgcatatattatgcatt |
32051567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 19260568 - 19260614
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
19260568 |
ggtggtggccggggtttgaaccccggaccttacatatattatgcatt |
19260614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 19778137 - 19778091
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19778137 |
ggtggtgtctaggattcgaaccccggaccttgcatatattatgcatt |
19778091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 24838159 - 24838205
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
24838159 |
ggtggtggccggggtttgaaccccggaccttgcatattttatgcatt |
24838205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 27587293 - 27587247
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
27587293 |
ggtggtggccggggtttgaaccccggaccttgcatatatcatgcatt |
27587247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 444484 - 444439
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
444484 |
gtggtggccggggtttaaaccccggaccttgcatatattatgcatt |
444439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 8881346 - 8881301
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
8881346 |
gtggtggccggggtttgaaccctggaccttgcatatattatgcatt |
8881301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 33105449 - 33105417
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
33105449 |
tttgaaccccggaccttgcatatattatgcatt |
33105417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 321 - 356
Target Start/End: Original strand, 12714370 - 12714405
Alignment:
| Q |
321 |
ggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12714370 |
ggatttgaaccccgaaccttgcatatattatgcatt |
12714405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 322 - 356
Target Start/End: Complemental strand, 6447249 - 6447215
Alignment:
| Q |
322 |
gatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6447249 |
gatttgaactccggaccttgcatatattatgcatt |
6447215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 6471583 - 6471537
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
6471583 |
ggtggtggccggggtttgaaccccgaacattgcatatattatgcatt |
6471537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 352
Target Start/End: Original strand, 12800889 - 12800931
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatg |
352 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
12800889 |
ggtggtggtcggggtttgaaccccggaccttgcatatattatg |
12800931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 318 - 356
Target Start/End: Original strand, 13124360 - 13124398
Alignment:
| Q |
318 |
ccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
13124360 |
ccggggtttgaaccccggaccttgcatattttatgcatt |
13124398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 314 - 356
Target Start/End: Complemental strand, 18942986 - 18942944
Alignment:
| Q |
314 |
gtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||| |||||| |||||||| ||||||||||||||||| |
|
|
| T |
18942986 |
gtgtccggggtttgaaacccggaccatgcatatattatgcatt |
18942944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 22775700 - 22775654
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| || || |||||||||||||||||||||| |||||||||| |
|
|
| T |
22775700 |
ggtggtggccagggtttgaaccccggaccttgcataaattatgcatt |
22775654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 29924906 - 29924952
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||| ||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
29924906 |
ggtggtgtctggggtttaaaccccgaaccttgcatatattatgcatt |
29924952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 31832079 - 31832125
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||| || ||| ||||||| |||||||||||||||||| |
|
|
| T |
31832079 |
ggtggtgtccggggttcgaaacccggacattgcatatattatgcatt |
31832125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 318 - 356
Target Start/End: Original strand, 33482146 - 33482184
Alignment:
| Q |
318 |
ccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
33482146 |
ccgggatttgaaccctggaccttgcataaattatgcatt |
33482184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 44975250 - 44975204
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||| || ||| |||| ||||||||||||||||||||| |
|
|
| T |
44975250 |
ggtggtgtccgggtttcgaatcccgaaccttgcatatattatgcatt |
44975204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 1244695 - 1244740
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||| || ||||||| ||||||| |||||||||||||| |
|
|
| T |
1244695 |
gtggtgtccggggttcgaaccccagaccttgtatatattatgcatt |
1244740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 315 - 356
Target Start/End: Original strand, 1877656 - 1877697
Alignment:
| Q |
315 |
tgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
1877656 |
tgtccgggattcgaacccgtgaccttgcatatattatgcatt |
1877697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 3650591 - 3650546
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||||||| ||||| ||||||||||||||| |
|
|
| T |
3650591 |
gtggtggccggggtttgaaccccgaaccttacatatattatgcatt |
3650546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Complemental strand, 4830071 - 4830034
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
4830071 |
cgggattcgaaccccgaaccttgcatatattatgcatt |
4830034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 7553750 - 7553705
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
7553750 |
gtggtgtccggagtttgaaccttggaccttgcatatattatgcatt |
7553705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 7839108 - 7839153
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
7839108 |
gtggtgttcgggattcgaaccccataccttgcatatattatgcatt |
7839153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 7968931 - 7968975
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| | ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7968931 |
gtggtggctgggatttgaaccc-ggaccttgcatatattatgcatt |
7968975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 352
Target Start/End: Original strand, 15147027 - 15147060
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
15147027 |
cgggatttgagccccggaccttgcatatattatg |
15147060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 16869597 - 16869552
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||||||||||||||| || ||||| |||||||||||| |
|
|
| T |
16869597 |
gtggtggccgggatttgaaccccgaactttgcaaatattatgcatt |
16869552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Original strand, 19163534 - 19163571
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
19163534 |
cggggtttgaaccccggaccttgcataaattatgcatt |
19163571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 19488371 - 19488326
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||| || |||| ||||||| |||||||||||||| |
|
|
| T |
19488371 |
gtggtgtccgggattcgagccccagaccttgtatatattatgcatt |
19488326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 20665353 - 20665398
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||| ||||||||||||||| ||||||||| |
|
|
| T |
20665353 |
gtggtggccggggtttgaactccggaccttgcatattttatgcatt |
20665398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 323 - 356
Target Start/End: Original strand, 22948083 - 22948116
Alignment:
| Q |
323 |
atttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
22948083 |
atttaaaccccggaccttgcatatattatgcatt |
22948116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Original strand, 24023413 - 24023450
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
24023413 |
cggggtttgaaccccggaccttgcatattttatgcatt |
24023450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Original strand, 27571847 - 27571884
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27571847 |
cgggatttgaaccccaaaccttgcatatattatgcatt |
27571884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 30550716 - 30550761
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||| ||||||||||||||| ||||||||| |
|
|
| T |
30550716 |
gtggtggccggggtttgaactccggaccttgcatattttatgcatt |
30550761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 37141428 - 37141383
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
37141428 |
gtggtggccggagtttgaaccccgaaccttgcatatattatgcatt |
37141383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Complemental strand, 37938558 - 37938521
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
37938558 |
cgggatttgaacctcggactttgcatatattatgcatt |
37938521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 352
Target Start/End: Complemental strand, 40795448 - 40795407
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatg |
352 |
Q |
| |
|
|||||| |||| ||| |||||||||||||||||||||||||| |
|
|
| T |
40795448 |
gtggtggccggaattagaaccccggaccttgcatatattatg |
40795407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 42208459 - 42208504
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| ||||| | |||||||| |||||||||||||||||||||||| |
|
|
| T |
42208459 |
gtggggtccgaggtttgaacctcggaccttgcatatattatgcatt |
42208504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 44215465 - 44215510
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||| ||||||||||||||| ||||||||| |
|
|
| T |
44215465 |
gtggtggccggggtttgaactccggaccttgcatattttatgcatt |
44215510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 311 - 355
Target Start/End: Original strand, 6235541 - 6235585
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcat |
355 |
Q |
| |
|
|||||| ||||| |||||| |||||||||| |||||||||||||| |
|
|
| T |
6235541 |
gtggtggccggggtttgaatcccggaccttacatatattatgcat |
6235585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 8717478 - 8717510
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
8717478 |
tttgaaccccgaaccttgcatatattatgcatt |
8717510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 10871897 - 10871929
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
10871897 |
tttgaaccccggaccttgcatacattatgcatt |
10871929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 328 - 356
Target Start/End: Complemental strand, 11053030 - 11053002
Alignment:
| Q |
328 |
aaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11053030 |
aaccccggaccttgcatatattatgcatt |
11053002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 328 - 356
Target Start/End: Complemental strand, 15438507 - 15438479
Alignment:
| Q |
328 |
aaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
15438507 |
aaccccggaccttgcatatattatgcatt |
15438479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 328 - 356
Target Start/End: Complemental strand, 15529811 - 15529783
Alignment:
| Q |
328 |
aaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
15529811 |
aaccccggaccttgcatatattatgcatt |
15529783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 18533727 - 18533695
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
18533727 |
tttgaaccccggatcttgcatatattatgcatt |
18533695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 352
Target Start/End: Complemental strand, 24195307 - 24195279
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatg |
352 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
24195307 |
tttgaaccccggaccttgcatatattatg |
24195279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 319 - 355
Target Start/End: Original strand, 26773800 - 26773836
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcat |
355 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26773800 |
cgggatttgaaccctagaccttgcatatattatgcat |
26773836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 27718897 - 27718929
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
27718897 |
tttgaactccggaccttgcatatattatgcatt |
27718929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 310 - 354
Target Start/End: Original strand, 32286353 - 32286397
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgca |
354 |
Q |
| |
|
||||||| ||||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
32286353 |
ggtggtggccggggtttgaaccccgaatcttgcatatattatgca |
32286397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 39821942 - 39821910
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
39821942 |
tttgaaccccagaccttgcatatattatgcatt |
39821910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 44794951 - 44794919
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
44794951 |
tttgaactccggaccttgcatatattatgcatt |
44794919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 53)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 27679569 - 27679524
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27679569 |
gtggtgtccgggatttgaaccccgaaccttgcatatattatgcatt |
27679524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 3445236 - 3445282
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3445236 |
ggtggtggccgggatttgaaccccggaccttgcatacattatgcatt |
3445282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 22522790 - 22522836
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22522790 |
ggtggtggccggggtttgaaccccggaccttgcatatattatgcatt |
22522836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 32339807 - 32339761
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32339807 |
ggtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
32339761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 40715939 - 40715984
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40715939 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcatt |
40715984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 6489079 - 6489033
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
6489079 |
ggtggtggccggggtttgaaccccagaccttgcatatattatgcatt |
6489033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 6624848 - 6624802
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
6624848 |
ggtggtggccggggttcgaaccccggaccttgcatatattatgcatt |
6624802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 319 - 356
Target Start/End: Original strand, 21139146 - 21139183
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21139146 |
cgggttttgaaccccggaccttgcatatattatgcatt |
21139183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 352
Target Start/End: Complemental strand, 35109471 - 35109430
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatg |
352 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
35109471 |
gtggtgtccgggattcgaacctcggaccttgcatatattatg |
35109430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 312 - 356
Target Start/End: Complemental strand, 5846099 - 5846055
Alignment:
| Q |
312 |
tggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||| |||||||||| ||| |||||||||||||||||| |
|
|
| T |
5846099 |
tggtgtccggggtttgaaccccagactttgcatatattatgcatt |
5846055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 42473952 - 42473920
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42473952 |
tttgaaccccggaccttgcatatattatgcatt |
42473920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 313 - 356
Target Start/End: Complemental strand, 11017245 - 11017202
Alignment:
| Q |
313 |
ggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||| ||||| | |||||||||||||||||||||| |
|
|
| T |
11017245 |
ggtgtccgggattcgaacctcagaccttgcatatattatgcatt |
11017202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 311 - 354
Target Start/End: Original strand, 26223592 - 26223635
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgca |
354 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
26223592 |
gtggtggccgggatttgaaccccggaccttgtatatataatgca |
26223635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 310 - 349
Target Start/End: Original strand, 31958457 - 31958496
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatatt |
349 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
31958457 |
ggtggtgtccggggttcgaaccccggaccttgcatatatt |
31958496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 325 - 356
Target Start/End: Original strand, 32200451 - 32200482
Alignment:
| Q |
325 |
ttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32200451 |
ttgaaccccggaccttgcatatattatgcatt |
32200482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 11720965 - 11720920
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
11720965 |
ggtggtggccggggtttgaaccccg-accttgcatatattatgcatt |
11720920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 311 - 353
Target Start/End: Complemental strand, 14474905 - 14474863
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgc |
353 |
Q |
| |
|
|||||| ||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
14474905 |
gtggtggccggggtttgaaccctggaccttgcatatattatgc |
14474863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 312 - 354
Target Start/End: Original strand, 25603991 - 25604033
Alignment:
| Q |
312 |
tggtgtccgggatttgaaccccggaccttgcatatattatgca |
354 |
Q |
| |
|
||||| |||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
25603991 |
tggtggccgggattcgaaccccgaaccttgcatatattatgca |
25604033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 26655536 - 26655490
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||| || |||||||||||||| ||||||||||||||| |
|
|
| T |
26655536 |
ggtggtggccggggttcgaaccccggaccttacatatattatgcatt |
26655490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 26927121 - 26927075
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||| || |||||||||||||| ||||||||||||||| |
|
|
| T |
26927121 |
ggtggtggccggggttcgaaccccggaccttacatatattatgcatt |
26927075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 31708135 - 31708181
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||| | || ||||||| |||||||||||||||||||||| |
|
|
| T |
31708135 |
ggtggtgtccgaggttcgaaccccagaccttgcatatattatgcatt |
31708181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 32559376 - 32559330
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| |||||||||||||||| |||||| ||||| ||||||||| |
|
|
| T |
32559376 |
ggtggtggccgggatttgaaccccagaccttacatattttatgcatt |
32559330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 318 - 356
Target Start/End: Complemental strand, 34191497 - 34191459
Alignment:
| Q |
318 |
ccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
34191497 |
ccggggtttgaaccccggaccttgcatattttatgcatt |
34191459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 34436923 - 34436877
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| |||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
34436923 |
ggtggtgggcggggtttgaaccccggcccttgcatatattatgcatt |
34436877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 42005177 - 42005131
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||| |||| |||||| |||||||||||||||||||||| |
|
|
| T |
42005177 |
ggtggtgtccgagattcaaaccccagaccttgcatatattatgcatt |
42005131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 43396926 - 43396880
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||| | |||| ||||||||| ||||||||||||||| |
|
|
| T |
43396926 |
ggtggtgtccgggaatcgaacaccggaccttacatatattatgcatt |
43396880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 352
Target Start/End: Complemental strand, 13864407 - 13864374
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatg |
352 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
13864407 |
cggggtttgaaccccggaccttgcatatattatg |
13864374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 17090937 - 17090892
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
17090937 |
gtggtggccggggtttgaaccccggaccttgcattaattatgcatt |
17090892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 18331778 - 18331733
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
18331778 |
gtggtggccggggcttgaaccccggaccttgcatattttatgcatt |
18331733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 18872738 - 18872693
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| || ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
18872738 |
gtggtgaccaggattcgaaccccgaaccttgcatatattatgcatt |
18872693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 352
Target Start/End: Complemental strand, 20721113 - 20721080
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatg |
352 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
20721113 |
cggggtttgaaccccggaccttgcatatattatg |
20721080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 28207203 - 28207158
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| |||||||| ||||| |||||||||||||| ||||||||| |
|
|
| T |
28207203 |
gtggtggccgggattcgaacctcggaccttgcatattttatgcatt |
28207158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 28604408 - 28604453
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||| |||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
28604408 |
gtggtgtccgtgattcgaaccccggaccttacatttattatgcatt |
28604453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 34702561 - 34702516
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| || ||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
34702561 |
gtggtggccaggattcgaaccccggacctttcatatattatgcatt |
34702516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 37462182 - 37462137
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||| ||||||||||||||| ||||||||| |
|
|
| T |
37462182 |
gtggtggccggggtttgaactccggaccttgcatattttatgcatt |
37462137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 327 - 356
Target Start/End: Complemental strand, 37932385 - 37932356
Alignment:
| Q |
327 |
gaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37932385 |
gaaccccggaccttgcatatattatgcatt |
37932356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 41630102 - 41630147
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| |||||| |||| ||||||||||||||||||||| |
|
|
| T |
41630102 |
gtggtgaccggggtttgaatcccgaaccttgcatatattatgcatt |
41630147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 43135184 - 43135228
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||| ||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
43135184 |
gtggtgtctgggatttgaaccc-ggaccttacatatattatgcatt |
43135228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 312 - 352
Target Start/End: Original strand, 1476101 - 1476141
Alignment:
| Q |
312 |
tggtgtccgggatttgaaccccggaccttgcatatattatg |
352 |
Q |
| |
|
|||||||||||||| |||||| | ||||||||||||||||| |
|
|
| T |
1476101 |
tggtgtccgggattcgaaccctgaaccttgcatatattatg |
1476141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 310 - 350
Target Start/End: Complemental strand, 4009939 - 4009899
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatatta |
350 |
Q |
| |
|
||||||| ||||| |||||||||||| |||||||||||||| |
|
|
| T |
4009939 |
ggtggtggccggggtttgaaccccggcccttgcatatatta |
4009899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 4763189 - 4763221
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
4763189 |
tttgaaccccggaccttacatatattatgcatt |
4763221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 6424906 - 6424938
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
6424906 |
tttgaaccccggaccttgtatatattatgcatt |
6424938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 10704334 - 10704366
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
10704334 |
tttgaaccccggaccttgcatattttatgcatt |
10704366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 12670077 - 12670109
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
12670077 |
tttgaaccccgaaccttgcatatattatgcatt |
12670109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 16579377 - 16579409
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
16579377 |
tttgaaccacggaccttgcatatattatgcatt |
16579409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 328 - 356
Target Start/End: Original strand, 18589874 - 18589902
Alignment:
| Q |
328 |
aaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18589874 |
aaccccggaccttgcatatattatgcatt |
18589902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 20688098 - 20688066
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
20688098 |
tttgaactccggaccttgcatatattatgcatt |
20688066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 319 - 355
Target Start/End: Complemental strand, 24408558 - 24408522
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcat |
355 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
24408558 |
cggggtttgaaccccagaccttgcatatattatgcat |
24408522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 25979902 - 25979870
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
25979902 |
tttgaaccccggaccttgcatacattatgcatt |
25979870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 27903171 - 27903139
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
27903171 |
tttgaaccccgaaccttgcatatattatgcatt |
27903139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 328 - 356
Target Start/End: Complemental strand, 33928693 - 33928665
Alignment:
| Q |
328 |
aaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33928693 |
aaccccggaccttgcatatattatgcatt |
33928665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 312 - 356
Target Start/End: Complemental strand, 42708045 - 42708001
Alignment:
| Q |
312 |
tggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||| |||||||| ||| ||| |||||||||||||||||||||| |
|
|
| T |
42708045 |
tggtggccgggattcgaatcccagaccttgcatatattatgcatt |
42708001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 42817115 - 42817147
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
42817115 |
tttgaaccccggaccttgtatatattatgcatt |
42817147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 66)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 20120711 - 20120756
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20120711 |
gtggtgtccgggatttgaaccccgaaccttgcatatattatgcatt |
20120756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 27848230 - 27848184
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27848230 |
ggtggtggccggggtttgaaccccggaccttgcatatattatgcatt |
27848184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 29544699 - 29544653
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29544699 |
ggtggtggccggggtttgaaccccggaccttgcatatattatgcatt |
29544653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 310 - 355
Target Start/End: Original strand, 10735820 - 10735865
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcat |
355 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10735820 |
ggtggtggccggggtttgaaccccggaccttgcatatattatgcat |
10735865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 20455962 - 20455917
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
20455962 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
20455917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 24592835 - 24592881
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
24592835 |
ggtggtggccggggtttgaaccccagaccttgcatatattatgcatt |
24592881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 31477043 - 31476997
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
31477043 |
ggtggtggccgggatttgaaccccgaaccttgtatatattatgcatt |
31476997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 36474834 - 36474788
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
36474834 |
ggtggtggccggaatttgaaccccggaccttgcatattttatgcatt |
36474788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 41778933 - 41778979
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| |||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
41778933 |
ggtggtggccgggattcgaacctcggaccttgcatatattatgcatt |
41778979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 318 - 356
Target Start/End: Complemental strand, 42791359 - 42791321
Alignment:
| Q |
318 |
ccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42791359 |
ccggggtttgaaccccggaccttgcatatattatgcatt |
42791321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 20200776 - 20200731
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
20200776 |
gtggtggccggggtttgaaccctggaccttgcatatattatgcatt |
20200731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 25186232 - 25186277
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| | ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25186232 |
gtggtggctggggtttgaaccccggaccttgcatatattatgcatt |
25186277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 319 - 356
Target Start/End: Original strand, 31815885 - 31815922
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31815885 |
cggggtttgaaccccggaccttgcatatattatgcatt |
31815922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 8091161 - 8091193
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
8091161 |
tttgaaccccggaccttgcatatattatgcatt |
8091193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 20565078 - 20565110
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
20565078 |
tttgaaccccggaccttgcatatattatgcatt |
20565110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 310 - 354
Target Start/End: Complemental strand, 27411164 - 27411120
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgca |
354 |
Q |
| |
|
||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
27411164 |
ggtggtggccggggttcgaaccccggaccttgcatatattatgca |
27411120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 31543070 - 31543038
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
31543070 |
tttgaaccccggaccttgcatatattatgcatt |
31543038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 36359372 - 36359340
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
36359372 |
tttgaaccccggaccttgcatatattatgcatt |
36359340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 7052846 - 7052799
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcata-tattatgcatt |
356 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||| ||||||||||| |
|
|
| T |
7052846 |
ggtggtgtccggggtttgagccccggaccttgcatattattatgcatt |
7052799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 4056862 - 4056816
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||| |||| |||| ||||||||||||||||||||||||| |
|
|
| T |
4056862 |
ggtggtgcccgagattcgaactccggaccttgcatatattatgcatt |
4056816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 318 - 356
Target Start/End: Original strand, 4122010 - 4122048
Alignment:
| Q |
318 |
ccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
4122010 |
ccgggatttaaaccccagaccttgcatatattatgcatt |
4122048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 318 - 356
Target Start/End: Original strand, 6579278 - 6579316
Alignment:
| Q |
318 |
ccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
6579278 |
ccgggattcgaaccccagaccttgcatatattatgcatt |
6579316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 322 - 356
Target Start/End: Original strand, 22571866 - 22571900
Alignment:
| Q |
322 |
gatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
22571866 |
gatttgaaccccggacattgcatatattatgcatt |
22571900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 318 - 356
Target Start/End: Complemental strand, 22709149 - 22709111
Alignment:
| Q |
318 |
ccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
22709149 |
ccggggtttgaaccccggaccttgcatattttatgcatt |
22709111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 24593448 - 24593402
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||| | || || |||||||||||||||||||||||||||||| |
|
|
| T |
24593448 |
ggtggtgttcagggttcgaaccccggaccttgcatatattatgcatt |
24593402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 27152425 - 27152379
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||| || || ||||||| |||||||||||||||||||||| |
|
|
| T |
27152425 |
ggtggtgtcctgggttcgaaccccagaccttgcatatattatgcatt |
27152379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 28771654 - 28771608
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||| || ||||| |||| ||||||||||||||||||| |
|
|
| T |
28771654 |
ggtggtgtccggggttcgaaccgcggatcttgcatatattatgcatt |
28771608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 35820290 - 35820336
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||| | ||||||||||||||||||||| ||||||||||| |
|
|
| T |
35820290 |
ggtggtggccgaggtttgaaccccggaccttgcatgtattatgcatt |
35820336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 352
Target Start/End: Complemental strand, 44810777 - 44810735
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatg |
352 |
Q |
| |
|
||||||| | ||| ||||||||||||||||||||||||||||| |
|
|
| T |
44810777 |
ggtggtggctggggtttgaaccccggaccttgcatatattatg |
44810735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Original strand, 660820 - 660857
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
660820 |
cggggtttgaaccctggaccttgcatatattatgcatt |
660857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 2257042 - 2256997
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
2257042 |
gtggtggccggggttcgaaccccagaccttgcatatattatgcatt |
2256997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Original strand, 3113725 - 3113762
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
3113725 |
cgggatttgaatcccggaccttgcatattttatgcatt |
3113762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 3708764 - 3708719
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||| ||||||||||||||| ||||||||| |
|
|
| T |
3708764 |
gtggtggccggggtttgaactccggaccttgcatattttatgcatt |
3708719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Complemental strand, 4180760 - 4180723
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
4180760 |
cggggtttgaaccccggaccttgcatattttatgcatt |
4180723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Original strand, 5168577 - 5168614
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
5168577 |
cggggtttgaaccccgaaccttgcatatattatgcatt |
5168614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Original strand, 8781648 - 8781685
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
8781648 |
cggggtttgaaccccggaccttgcatacattatgcatt |
8781685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 10724010 - 10723965
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| |||||||| | |||||||||||||||||||||| |
|
|
| T |
10724010 |
gtggtggccggggtttgaacctcagaccttgcatatattatgcatt |
10723965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 11868652 - 11868697
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||| ||||||||||||||| ||||||||| |
|
|
| T |
11868652 |
gtggtggccggggtttgaactccggaccttgcatattttatgcatt |
11868697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 327 - 356
Target Start/End: Complemental strand, 12124600 - 12124571
Alignment:
| Q |
327 |
gaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12124600 |
gaaccccggaccttgcatatattatgcatt |
12124571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 12413564 - 12413519
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| |||| |||||||| | |||||||||||||||||||||| |
|
|
| T |
12413564 |
gtggtgtacggggtttgaacctcagaccttgcatatattatgcatt |
12413519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 12425624 - 12425579
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| |||| |||||||| | |||||||||||||||||||||| |
|
|
| T |
12425624 |
gtggtgtacggggtttgaacctcagaccttgcatatattatgcatt |
12425579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 310 - 355
Target Start/End: Complemental strand, 16390675 - 16390630
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcat |
355 |
Q |
| |
|
||||||| ||||| || |||||||||||||||||||| |||||||| |
|
|
| T |
16390675 |
ggtggtggccggggttcgaaccccggaccttgcatattttatgcat |
16390630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 17842702 - 17842747
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||| |||||||| ||||| ||| ||||||||||||||| |
|
|
| T |
17842702 |
gtggtgtccggaatttgaactccggatcttacatatattatgcatt |
17842747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 21258687 - 21258642
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| |||||||| ||||||| |||||||||||||| ||||||| |
|
|
| T |
21258687 |
gtggtggccgggattcgaaccccagaccttgcatatatcatgcatt |
21258642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 352
Target Start/End: Original strand, 22523002 - 22523043
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatg |
352 |
Q |
| |
|
|||||| |||||||||||||| || ||||||||||||||||| |
|
|
| T |
22523002 |
gtggtggccgggatttgaacctcgaaccttgcatatattatg |
22523043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 22607223 - 22607178
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||| | |||||||||||||| ||||||||||||||| |
|
|
| T |
22607223 |
gtggtgtccggggctcgaaccccggaccttacatatattatgcatt |
22607178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Original strand, 23250318 - 23250355
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
23250318 |
cggggtttgaaccctggaccttgcatatattatgcatt |
23250355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 24393316 - 24393271
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||| || ||||| | |||||||||||||||||||||| |
|
|
| T |
24393316 |
gtggtgtccggggttcgaacctcagaccttgcatatattatgcatt |
24393271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Complemental strand, 29734754 - 29734717
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
29734754 |
cggggtttgaaccacggaccttgcatatattatgcatt |
29734717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 29809397 - 29809352
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| |||||||| |||||||| ||||| ||||||||||||||| |
|
|
| T |
29809397 |
gtggtggccgggattcgaaccccgtacctttcatatattatgcatt |
29809352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 35360045 - 35360090
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||| ||||||||||||||| ||||||||| |
|
|
| T |
35360045 |
gtggtggccggggtttgaactccggaccttgcatattttatgcatt |
35360090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 312 - 356
Target Start/End: Complemental strand, 9718464 - 9718420
Alignment:
| Q |
312 |
tggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||| | ||| |||||| |||||||||||| |
|
|
| T |
9718464 |
tggtgtccgggatttgaactctggaacttgcaaatattatgcatt |
9718420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 311 - 355
Target Start/End: Original strand, 15447704 - 15447748
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcat |
355 |
Q |
| |
|
|||||| ||||| ||||||| || ||||||||||||||||||||| |
|
|
| T |
15447704 |
gtggtggccggggtttgaactccagaccttgcatatattatgcat |
15447748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 310 - 354
Target Start/End: Original strand, 20017045 - 20017089
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgca |
354 |
Q |
| |
|
||||||| ||| ||||||||| ||||||||||||||||| ||||| |
|
|
| T |
20017045 |
ggtggtggccgagatttgaactccggaccttgcatatataatgca |
20017089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 23407021 - 23407053
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
23407021 |
tttgaaccccagaccttgcatatattatgcatt |
23407053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 24579671 - 24579703
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
24579671 |
tttgaaccctggaccttgcatatattatgcatt |
24579703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 29599997 - 29599965
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
29599997 |
tttgaaccccggaccttggatatattatgcatt |
29599965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 30089107 - 30089075
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
30089107 |
tttgaaccccggaccttgtatatattatgcatt |
30089075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 30125711 - 30125679
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
30125711 |
tttgaaccccggaccttgtatatattatgcatt |
30125679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 30978420 - 30978388
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
30978420 |
tttgaacccctgaccttgcatatattatgcatt |
30978388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 32458360 - 32458328
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
32458360 |
tttgaaccctggaccttgcatatattatgcatt |
32458328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 312 - 356
Target Start/End: Complemental strand, 34977274 - 34977230
Alignment:
| Q |
312 |
tggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||| ||||| ||| ||| ||||||||||||||||||||||||| |
|
|
| T |
34977274 |
tggtggccggggtttaaactccggaccttgcatatattatgcatt |
34977230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 319 - 355
Target Start/End: Original strand, 40853816 - 40853852
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcat |
355 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
40853816 |
cggggtttgatccccggaccttgcatatattatgcat |
40853852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 312 - 356
Target Start/End: Complemental strand, 41859922 - 41859878
Alignment:
| Q |
312 |
tggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||| ||||| |||||||||| |||||||||||| ||||||||| |
|
|
| T |
41859922 |
tggtggccggggtttgaaccccagaccttgcatattttatgcatt |
41859878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 43043168 - 43043200
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
43043168 |
tttgaaccccggaccttgcatacattatgcatt |
43043200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 312 - 356
Target Start/End: Complemental strand, 44526198 - 44526154
Alignment:
| Q |
312 |
tggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||| ||||| |||||| |||||||||||| ||||||||||||| |
|
|
| T |
44526198 |
tggtggccggggtttgaatcccggaccttgcgtatattatgcatt |
44526154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 61)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 18714520 - 18714474
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18714520 |
ggtggtgtacggggtttgaaccccggaccttgcatatattatgcatt |
18714474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 46987158 - 46987112
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
46987158 |
ggtggtgtccggggttcgaaccccggaccttgcatatattatgcatt |
46987112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 27462426 - 27462471
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27462426 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcatt |
27462471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 19416586 - 19416540
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
19416586 |
ggtggtggccggggtttgaaccccggaccttgcatattttatgcatt |
19416540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 45425525 - 45425479
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| |||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
45425525 |
ggtggtggccgggattcgaaccccgaaccttgcatatattatgcatt |
45425479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 47155093 - 47155139
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||| || |||||| ||||||||||||||||||||||| |
|
|
| T |
47155093 |
ggtggtgtccggggttcgaaccctggaccttgcatatattatgcatt |
47155139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 10244797 - 10244753
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10244797 |
gtggtggccggg-tttgaaccccggaccttgcatatattatgcatt |
10244753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 319 - 356
Target Start/End: Complemental strand, 19599208 - 19599171
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
19599208 |
cggggtttgaaccccggaccttgcatatattatgcatt |
19599171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 37624614 - 37624569
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| |||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
37624614 |
gtggtggccgggattcgaacccccgaccttgcatatattatgcatt |
37624569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 48527261 - 48527216
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| |||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
48527261 |
gtggtggccgggattcgaactccggaccttgcatatattatgcatt |
48527216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 7670492 - 7670460
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
7670492 |
tttgaaccccggaccttgcatatattatgcatt |
7670460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 19626528 - 19626560
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
19626528 |
tttgaaccccggaccttgcatatattatgcatt |
19626560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 20085762 - 20085794
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
20085762 |
tttgaaccccggaccttgcatatattatgcatt |
20085794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 39280821 - 39280853
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
39280821 |
tttgaaccccggaccttgcatatattatgcatt |
39280853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 46737843 - 46737811
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
46737843 |
tttgaaccccggaccttgcatatattatgcatt |
46737811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 324 - 355
Target Start/End: Original strand, 42095946 - 42095977
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcat |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42095946 |
tttgaaccccggaccttgcatatattatgcat |
42095977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 322 - 356
Target Start/End: Original strand, 1079693 - 1079727
Alignment:
| Q |
322 |
gatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1079693 |
gatttgaaccccggaccttgcatattttatgcatt |
1079727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 322 - 356
Target Start/End: Complemental strand, 2618739 - 2618705
Alignment:
| Q |
322 |
gatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
2618739 |
gattcgaaccccggaccttgcatatattatgcatt |
2618705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 7872737 - 7872783
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||| || || ||||||| |||||||||||||||||||||| |
|
|
| T |
7872737 |
ggtggtgtcctgggttcgaaccccagaccttgcatatattatgcatt |
7872783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 8084499 - 8084453
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||| || |||||||||||||||||||| ||||||||| |
|
|
| T |
8084499 |
ggtggtggccggggttcgaaccccggaccttgcatattttatgcatt |
8084453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 21322247 - 21322201
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||| ||||||||| |||||||||||| |||||||||| |
|
|
| T |
21322247 |
ggtggtggccggggtttgaaccctggaccttgcatacattatgcatt |
21322201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 27833390 - 27833436
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| |||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
27833390 |
ggtggtggtcggggtttgaaccccggaccttacatatattatgcatt |
27833436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 324 - 354
Target Start/End: Original strand, 42753530 - 42753560
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgca |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
42753530 |
tttgaaccccggaccttgcatatattatgca |
42753560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 3830139 - 3830094
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| | ||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
3830139 |
gtggtggctggggtttgaaccctggaccttgcatatattatgcatt |
3830094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Complemental strand, 10242543 - 10242506
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
10242543 |
cggggtttgaaccctggaccttgcatatattatgcatt |
10242506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 14046601 - 14046646
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||||||| | ||||||||||||||||||| |
|
|
| T |
14046601 |
gtggtggccggggtttgaaccccgtatcttgcatatattatgcatt |
14046646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 14356631 - 14356676
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||||||| | ||||||||||||||||||| |
|
|
| T |
14356631 |
gtggtggccggggtttgaaccccgtatcttgcatatattatgcatt |
14356676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Complemental strand, 14671233 - 14671196
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
14671233 |
cgggattcgaaccccggaccttgtatatattatgcatt |
14671196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 16198454 - 16198409
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||| |||| |||| ||||||||||||||||||||||||| |
|
|
| T |
16198454 |
gtggtggccgagattcgaactccggaccttgcatatattatgcatt |
16198409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 20763225 - 20763180
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||| ||||||||||||||| ||||||||| |
|
|
| T |
20763225 |
gtggtggccggggtttgaactccggaccttgcatattttatgcatt |
20763180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 22690026 - 22690071
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
22690026 |
gtggtgtccggggttcgaaccccaaaccttgcatatattatgcatt |
22690071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 22777350 - 22777394
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| |||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
22777350 |
gtggtggccgggattcgaaccccg-accttgcatatattatgcatt |
22777394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 318 - 351
Target Start/End: Complemental strand, 23147354 - 23147321
Alignment:
| Q |
318 |
ccgggatttgaaccccggaccttgcatatattat |
351 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
23147354 |
ccggggtttgaaccccggaccttgcatatattat |
23147321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 25288735 - 25288690
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| | ||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
25288735 |
gtggtggctgggatttgaactccggaccttgcatatcttatgcatt |
25288690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 26009347 - 26009302
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
26009347 |
gtggtgtccggagttcgaaccccagaccttgcatatattatgcatt |
26009302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 26973774 - 26973819
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||| ||| ||||||||| ||||||||||||||| |
|
|
| T |
26973774 |
gtggtgtccgggattcaaacgccggaccttacatatattatgcatt |
26973819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 29488791 - 29488746
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||| ||||||||||||||| ||||||||| |
|
|
| T |
29488791 |
gtggtggccggggtttgaactccggaccttgcatattttatgcatt |
29488746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 33232387 - 33232432
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||| ||||||||||||||| ||||||||| |
|
|
| T |
33232387 |
gtggtggccggggtttgaactccggaccttgcatattttatgcatt |
33232432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 34000333 - 34000288
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| |||| |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
34000333 |
gtggtggccggtatttgaaccccgaaccttacatatattatgcatt |
34000288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 34284529 - 34284574
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||| ||||||||||||||| ||||||||| |
|
|
| T |
34284529 |
gtggtggccggggtttgaactccggaccttgcatattttatgcatt |
34284574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 318 - 355
Target Start/End: Complemental strand, 36121716 - 36121679
Alignment:
| Q |
318 |
ccgggatttgaaccccggaccttgcatatattatgcat |
355 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
36121716 |
ccggggtttgaaccccggaccttgcatattttatgcat |
36121679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 323 - 356
Target Start/End: Original strand, 37230030 - 37230063
Alignment:
| Q |
323 |
atttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
37230030 |
atttgaaccccagaccttgcatatattatgcatt |
37230063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Original strand, 37495916 - 37495953
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37495916 |
cgggatttgaaccttggaccttgcatatattatgcatt |
37495953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Complemental strand, 41029335 - 41029298
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
41029335 |
cgggattcgaaccccggaccttgcatatattatacatt |
41029298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 42829224 - 42829269
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| |||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
42829224 |
gtggtggccggagtttgaaccccggagcttgcatatattatgcatt |
42829269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Original strand, 48629063 - 48629100
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
48629063 |
cggggtttaaaccccggaccttgcatatattatgcatt |
48629100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 310 - 350
Target Start/End: Complemental strand, 145590 - 145550
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatatta |
350 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
145590 |
ggtggtggtcggggtttgaaccccggaccttgcatatatta |
145550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 327 - 355
Target Start/End: Original strand, 394366 - 394394
Alignment:
| Q |
327 |
gaaccccggaccttgcatatattatgcat |
355 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
394366 |
gaaccccggaccttgcatatattatgcat |
394394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 312 - 356
Target Start/End: Original strand, 2962717 - 2962761
Alignment:
| Q |
312 |
tggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||| |||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
2962717 |
tggtggccgggattcaaaccccgaaccttgcatatattatgcatt |
2962761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 5041397 - 5041365
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
5041397 |
tttgaaccccagaccttgcatatattatgcatt |
5041365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 310 - 354
Target Start/End: Complemental strand, 5579765 - 5579721
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgca |
354 |
Q |
| |
|
||||||| |||| |||||||||| |||||||||||||||||||| |
|
|
| T |
5579765 |
ggtggtggtcggggtttgaaccccagaccttgcatatattatgca |
5579721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 320 - 356
Target Start/End: Original strand, 5963826 - 5963862
Alignment:
| Q |
320 |
gggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
5963826 |
gggatttgaaccccgaaccttgcatattttatgcatt |
5963862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 312 - 356
Target Start/End: Original strand, 6768698 - 6768742
Alignment:
| Q |
312 |
tggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||| |||| ||||| | |||||||||||||||||||||| |
|
|
| T |
6768698 |
tggtgtccgagattcgaacctcagaccttgcatatattatgcatt |
6768742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 18023737 - 18023705
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
18023737 |
tttgaaccctggaccttgcatatattatgcatt |
18023705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 26717931 - 26717963
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
26717931 |
tttgaaccctggaccttgcatatattatgcatt |
26717963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 40867088 - 40867056
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
40867088 |
tttgaaccccggaccttgcatatactatgcatt |
40867056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 43539107 - 43539139
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
43539107 |
tttgaaccccggaccttacatatattatgcatt |
43539139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 352
Target Start/End: Original strand, 45046218 - 45046246
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatg |
352 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45046218 |
tttgaaccccggaccttgcatatattatg |
45046246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 46371039 - 46371007
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
46371039 |
tttgaaccccggaccttggatatattatgcatt |
46371007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 315 - 351
Target Start/End: Original strand, 46418522 - 46418558
Alignment:
| Q |
315 |
tgtccgggatttgaaccccggaccttgcatatattat |
351 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
46418522 |
tgtccggggtttgaaccccggactttgcatatattat |
46418558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 47342437 - 47342469
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
47342437 |
tttgaactccggaccttgcatatattatgcatt |
47342469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 57)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 25727956 - 25728002
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25727956 |
ggtggtggtcgggatttgaaccccggaccttgcatatattatgcatt |
25728002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 38130948 - 38130994
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38130948 |
ggtggtggccggggtttgaaccccggaccttgcatatattatgcatt |
38130994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 319 - 356
Target Start/End: Original strand, 48315022 - 48315059
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48315022 |
cgggatttgaaccccggaccttgcatatattatgcatt |
48315059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 48849753 - 48849798
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48849753 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcatt |
48849798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 321 - 356
Target Start/End: Original strand, 40575609 - 40575644
Alignment:
| Q |
321 |
ggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
40575609 |
ggatttgaaccccggaccttgcatatattatgcatt |
40575644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 4601916 - 4601870
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
4601916 |
ggtggtggccggggtttgaaccccggaccttgcatttattatgcatt |
4601870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 16792963 - 16793009
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
16792963 |
ggtggtgaccggggtttgaaccctggaccttgcatatattatgcatt |
16793009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 25340913 - 25340959
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
25340913 |
ggtggtggccggggtttgaaccccggaccttgcatattttatgcatt |
25340959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 45334261 - 45334215
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45334261 |
ggtggtggtcgggatttgaaccccgaaccttgcatatattatgcatt |
45334215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 55066589 - 55066635
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| |||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
55066589 |
ggtggtggccgggatttgaaccccagaccatgcatatattatgcatt |
55066635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 334837 - 334882
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
334837 |
gtggtggccggggtttgaaccccggaccttgcatattttatgcatt |
334882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 14771402 - 14771357
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||| ||||| | |||||||||||||||||||||| |
|
|
| T |
14771402 |
gtggtgtccgggattcgaacctcagaccttgcatatattatgcatt |
14771357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 25441490 - 25441535
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
25441490 |
gtggtggccggggtttgaaccccagaccttgcatatattatgcatt |
25441535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 28130924 - 28130969
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
28130924 |
gtggtgtccgggattcaaaccccagaccttgcatatattatgcatt |
28130969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 32909291 - 32909336
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
32909291 |
gtggtggccgggatttgaacccaggaccttgcatattttatgcatt |
32909336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 319 - 356
Target Start/End: Complemental strand, 34899160 - 34899123
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34899160 |
cggggtttgaaccccggaccttgcatatattatgcatt |
34899123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 315 - 356
Target Start/End: Original strand, 35126263 - 35126304
Alignment:
| Q |
315 |
tgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
35126263 |
tgtccgggatttgaaccccagatcttgcatatattatgcatt |
35126304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 37920988 - 37921033
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||| | ||| |||||||||||||||||| |
|
|
| T |
37920988 |
gtggtgtccgggatttgaaccgcagacattgcatatattatgcatt |
37921033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 45432019 - 45431974
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| || || ||||||||||||||||||||||||||||||||| |
|
|
| T |
45432019 |
gtggtggccagggtttgaaccccggaccttgcatatattatgcatt |
45431974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 51614280 - 51614235
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
51614280 |
gtggtgtccgggattcgaacctcggaccttgcatatattttgcatt |
51614235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 53996370 - 53996325
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| |||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
53996370 |
gtggtggccgggattcgaaccccagaccttgcatatattatgcatt |
53996325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 913603 - 913635
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
913603 |
tttgaaccccggaccttgcatatattatgcatt |
913635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 16663239 - 16663271
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
16663239 |
tttgaaccccggaccttgcatatattatgcatt |
16663271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 312 - 356
Target Start/End: Complemental strand, 19468521 - 19468477
Alignment:
| Q |
312 |
tggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||| ||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
19468521 |
tggtgtcccggattcgaaccacggaccttgcatatattatgcatt |
19468477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 41817557 - 41817525
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
41817557 |
tttgaaccccggaccttgcatatattatgcatt |
41817525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 320 - 356
Target Start/End: Original strand, 47099034 - 47099070
Alignment:
| Q |
320 |
gggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47099034 |
gggatttgaaccccgaaccttgcatatattatgcatt |
47099070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 48656902 - 48656934
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
48656902 |
tttgaaccccggaccttgcatatattatgcatt |
48656934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 310 - 346
Target Start/End: Complemental strand, 53365976 - 53365940
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatat |
346 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53365976 |
ggtggtggccgggatttgaaccccggaccttgcatat |
53365940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 321 - 356
Target Start/End: Original strand, 977941 - 977976
Alignment:
| Q |
321 |
ggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
977941 |
ggatttgaactccggaccttgcatatattatgcatt |
977976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 10926541 - 10926495
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
10926541 |
ggtggtggccgacatttgaaccccgaaccttgcatatattatgcatt |
10926495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 352
Target Start/End: Complemental strand, 11358306 - 11358264
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatg |
352 |
Q |
| |
|
||||||| ||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
11358306 |
ggtggtggccggggtttgaaccccggatcttgcatatattatg |
11358264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 355
Target Start/End: Original strand, 20906469 - 20906515
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatat-attatgcat |
355 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
20906469 |
ggtggtgtctggggtttgaaccccggaccttgcatataattatgcat |
20906515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 22251449 - 22251495
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||| || |||||||||||| ||||||||||||||||| |
|
|
| T |
22251449 |
ggtggtggccggggttcgaaccccggaccgtgcatatattatgcatt |
22251495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 25505691 - 25505736
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
25505691 |
ggtggtgtccggg-ttcgaaccccagaccttgcatatattatgcatt |
25505736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 29631258 - 29631212
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||| |||||| |||| ||||||||||||||||||||| |
|
|
| T |
29631258 |
ggtggtggccggggtttgaatcccgaaccttgcatatattatgcatt |
29631212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 916510 - 916465
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||| ||||||||||||||| ||||||||| |
|
|
| T |
916510 |
gtggtggccggggtttgaactccggaccttgcatattttatgcatt |
916465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Original strand, 7464489 - 7464526
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
7464489 |
cggggtttgaaccccggaccttacatatattatgcatt |
7464526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 8075856 - 8075811
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| |||||||| | |||||||||||||||||||||| |
|
|
| T |
8075856 |
gtggtggccggggtttgaacctcagaccttgcatatattatgcatt |
8075811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 8113552 - 8113597
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| |||||||| ||||| |||| ||||||||||||||||||| |
|
|
| T |
8113552 |
gtggtggccgggattcgaaccgcggatcttgcatatattatgcatt |
8113597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 8238635 - 8238590
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
8238635 |
gtggtggccggagtttgaaccccagaccttgcatatattatgcatt |
8238590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Original strand, 10922306 - 10922343
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
10922306 |
cggggtttgaaccccggatcttgcatatattatgcatt |
10922343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 315 - 356
Target Start/End: Original strand, 14160272 - 14160313
Alignment:
| Q |
315 |
tgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
14160272 |
tgtccggggttcgaaccccggactttgcatatattatgcatt |
14160313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 327 - 356
Target Start/End: Complemental strand, 28266771 - 28266742
Alignment:
| Q |
327 |
gaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
28266771 |
gaaccccggaccttgcatatattatgcatt |
28266742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 32843252 - 32843297
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| |||||||||| |||||||||||| ||||||||| |
|
|
| T |
32843252 |
gtggtggccggggtttgaaccccagaccttgcatattttatgcatt |
32843297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 44075146 - 44075191
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||| ||||||||||||||| ||||||||| |
|
|
| T |
44075146 |
gtggtggccggggtttgaactccggaccttgcatattttatgcatt |
44075191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 48796208 - 48796253
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||||||| ||||||||||| ||||||||| |
|
|
| T |
48796208 |
gtggtggccggggtttgaaccccgaaccttgcatatcttatgcatt |
48796253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 51882190 - 51882235
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||||| ||| ||||||||||||||||||| |
|
|
| T |
51882190 |
gtggtggccggggtttgaaccctggatcttgcatatattatgcatt |
51882235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 4332670 - 4332702
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
4332670 |
tttgaaccccggaccttggatatattatgcatt |
4332702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 7626464 - 7626496
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
7626464 |
tttgaaccccggaccttgcatattttatgcatt |
7626496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 314 - 354
Target Start/End: Complemental strand, 17218559 - 17218519
Alignment:
| Q |
314 |
gtgtccgggatttgaaccccggaccttgcatatattatgca |
354 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||| |||||| |
|
|
| T |
17218559 |
gtgtccggggtttgaaccccggcccttgcatataatatgca |
17218519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 312 - 356
Target Start/End: Original strand, 28965768 - 28965812
Alignment:
| Q |
312 |
tggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||| ||||| ||||||||||| ||||| ||||||||||||||| |
|
|
| T |
28965768 |
tggtgaccggggtttgaaccccgaaccttacatatattatgcatt |
28965812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 35347298 - 35347330
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
35347298 |
tttgaaccccagaccttgcatatattatgcatt |
35347330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 319 - 351
Target Start/End: Complemental strand, 38798923 - 38798891
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattat |
351 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
38798923 |
cgggatttgaacctcggaccttgcatatattat |
38798891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 39779082 - 39779050
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
39779082 |
tttgaaccccgaaccttgcatatattatgcatt |
39779050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 312 - 356
Target Start/End: Original strand, 46226016 - 46226060
Alignment:
| Q |
312 |
tggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| |||| || |||| ||||||||||||||||||||||||| |
|
|
| T |
46226016 |
tggtgttcggggttcgaactccggaccttgcatatattatgcatt |
46226060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 49975808 - 49975840
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
49975808 |
tttgaaccccagaccttgcatatattatgcatt |
49975840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 312 - 356
Target Start/End: Complemental strand, 52119446 - 52119402
Alignment:
| Q |
312 |
tggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||| ||||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
52119446 |
tggtggccggggttcgaaccccgaaccttgcatatattatgcatt |
52119402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 75396 - 75351
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
75396 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcatt |
75351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 43)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 8569780 - 8569735
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8569780 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcatt |
8569735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 12184579 - 12184534
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12184579 |
gtggtggccgggatttgaaccacggaccttgcatatattatgcatt |
12184534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 322 - 356
Target Start/End: Complemental strand, 12215813 - 12215779
Alignment:
| Q |
322 |
gatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
12215813 |
gatttgaaccccggaccttgcatatattatgcatt |
12215779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 16204779 - 16204825
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
16204779 |
ggtggtggtcgggatttgaaccccggaccttgcatacattatgcatt |
16204825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 2726407 - 2726452
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
2726407 |
gtggtgaccggggttcgaaccccggaccttgcatatattatgcatt |
2726452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 4450333 - 4450288
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
4450333 |
gtggtgaccgagattcgaaccccggaccttgcatatattatgcatt |
4450288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 310 - 355
Target Start/End: Original strand, 10496961 - 10497005
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcat |
355 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
10496961 |
ggtggtgtccgg-atttgaaccccagaccttgcatatattatgcat |
10497005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 29740553 - 29740508
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
29740553 |
gtggtggccggggtttgaaccccggaccttgcgtatattatgcatt |
29740508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 33824939 - 33824907
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
33824939 |
tttgaaccccggaccttgcatatattatgcatt |
33824907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 324 - 355
Target Start/End: Complemental strand, 291425 - 291394
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcat |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
291425 |
tttgaaccccggaccttgcatatattatgcat |
291394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 318 - 356
Target Start/End: Original strand, 655746 - 655784
Alignment:
| Q |
318 |
ccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
655746 |
ccggggttcgaaccccggaccttgcatatattatgcatt |
655784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 9333803 - 9333757
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||| ||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
9333803 |
ggtggtggccgagatttaaaccccggaccttgcatatataatgcatt |
9333757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 14049873 - 14049919
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| |||| ||||||||| | |||||||||||||||||||||| |
|
|
| T |
14049873 |
ggtggtggccggaatttgaacctcagaccttgcatatattatgcatt |
14049919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 318 - 352
Target Start/End: Original strand, 14429125 - 14429159
Alignment:
| Q |
318 |
ccgggatttgaaccccggaccttgcatatattatg |
352 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14429125 |
ccgggatttgaaccccggaccttgcatattttatg |
14429159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 352
Target Start/End: Complemental strand, 21847266 - 21847224
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatg |
352 |
Q |
| |
|
||||||| |||||||| |||||||| ||||||||||||||||| |
|
|
| T |
21847266 |
ggtggtggccgggattcgaaccccgtaccttgcatatattatg |
21847224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 27907940 - 27907986
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||| ||||| |||||||||| |||||||||||| ||||||||| |
|
|
| T |
27907940 |
ggtggtggccggggtttgaaccccagaccttgcatattttatgcatt |
27907986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 326 - 356
Target Start/End: Original strand, 28231430 - 28231460
Alignment:
| Q |
326 |
tgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
28231430 |
tgaaccccggaccttgcatatattatgcatt |
28231460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 28758279 - 28758325
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||| |||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
28758279 |
ggtggtgttcggggtttgaacctcggactttgcatatattatgcatt |
28758325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 318 - 356
Target Start/End: Complemental strand, 33976308 - 33976270
Alignment:
| Q |
318 |
ccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
33976308 |
ccggggtttgaaccccggaccttgcatattttatgcatt |
33976270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 247730 - 247685
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||| ||||||| ||||||||||||||| ||||||||| |
|
|
| T |
247730 |
gtggtggccggggtttgaactccggaccttgcatattttatgcatt |
247685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 352
Target Start/End: Original strand, 8916464 - 8916505
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatg |
352 |
Q |
| |
|
|||||| ||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
8916464 |
gtggtggccgagatttgaactccggaccttgcatatattatg |
8916505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 327 - 356
Target Start/End: Complemental strand, 9111102 - 9111073
Alignment:
| Q |
327 |
gaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9111102 |
gaaccccggaccttgcatatattatgcatt |
9111073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Complemental strand, 13496179 - 13496142
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
13496179 |
cggggtttgaactccggaccttgcatatattatgcatt |
13496142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 14750149 - 14750193
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| ||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
14750149 |
gtggtggccgggatttaaaccc-ggaccttgcatatattatgcatt |
14750193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Complemental strand, 15187126 - 15187089
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
15187126 |
cggggtttgaacctcggaccttgcatatattatgcatt |
15187089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Original strand, 15473480 - 15473517
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
15473480 |
cggggtttgaacctcggaccttgcatatattatgcatt |
15473517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Complemental strand, 20744201 - 20744164
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
20744201 |
cggggtttgaaccccagaccttgcatatattatgcatt |
20744164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 323 - 356
Target Start/End: Original strand, 21029368 - 21029401
Alignment:
| Q |
323 |
atttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
21029368 |
atttgaaccccgaaccttgcatatattatgcatt |
21029401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 24373700 - 24373745
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| | ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
24373700 |
gtggtggctggggtttgaacccctgaccttgcatatattatgcatt |
24373745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 26587463 - 26587418
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| |||||||| |||||| | ||||||||||||||||||||| |
|
|
| T |
26587463 |
gtggtggccgggattcgaacccagaaccttgcatatattatgcatt |
26587418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 32193849 - 32193894
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| | |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
32193849 |
gtggtggcggggatttgaacctcgtaccttgcatatattatgcatt |
32193894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 356
Target Start/End: Original strand, 34481412 - 34481449
Alignment:
| Q |
319 |
cgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
34481412 |
cggggtttgaaccccggaccttgcatatataatgcatt |
34481449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 8629699 - 8629731
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
8629699 |
tttgaaccccgaaccttgcatatattatgcatt |
8629731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 8637440 - 8637472
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
8637440 |
tttgaacctcggaccttgcatatattatgcatt |
8637472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 8639104 - 8639072
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
8639104 |
tttgaaccccggaccttgcatatactatgcatt |
8639072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 9977115 - 9977083
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
9977115 |
tttgaaccccagaccttgcatatattatgcatt |
9977083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 15155793 - 15155761
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
15155793 |
tttgaaccccagaccttgcatatattatgcatt |
15155761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 16390487 - 16390455
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
16390487 |
tttgaaccccggaccttacatatattatgcatt |
16390455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 18253342 - 18253374
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
18253342 |
tttgaaccctggaccttgcatatattatgcatt |
18253374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 19265527 - 19265559
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
19265527 |
tttgaaccccggaccttgcatattttatgcatt |
19265559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 26356084 - 26356116
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
26356084 |
tttgaaccccgaaccttgcatatattatgcatt |
26356116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 312 - 356
Target Start/End: Original strand, 30639417 - 30639461
Alignment:
| Q |
312 |
tggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||| |||| ||||| | |||||||||||||||||||||| |
|
|
| T |
30639417 |
tggtgtccgagattcgaacctcagaccttgcatatattatgcatt |
30639461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 31971587 - 31971555
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
31971587 |
tttgaacctcggaccttgcatatattatgcatt |
31971555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0040 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0040
Description:
Target: scaffold0040; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 311 - 354
Target Start/End: Original strand, 53767 - 53810
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgca |
354 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
53767 |
gtggtgtccgggattcgaaccccggaccttgcatgtattatgca |
53810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1619 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold1619
Description:
Target: scaffold1619; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 1102 - 1057
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||| ||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
1102 |
gtggtgtctggggtttgaatcccggaccttgcatatattatgcatt |
1057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0066
Description:
Target: scaffold0066; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 17575 - 17530
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
17575 |
gtggtgtccgggattcgaaccccaaaccttgcatatattatgcatt |
17530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1127 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold1127
Description:
Target: scaffold1127; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 1168 - 1200
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1168 |
tttgaaccccggaccttgcatatattatgcatt |
1200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 312 - 356
Target Start/End: Complemental strand, 37605 - 37561
Alignment:
| Q |
312 |
tggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
37605 |
tggtggccgggattcgaaccccggaccttgcatattttatgcatt |
37561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 312 - 356
Target Start/End: Complemental strand, 48717 - 48673
Alignment:
| Q |
312 |
tggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||| |||||| ||||||| |||||||||||||||||| |
|
|
| T |
48717 |
tggtgtccggggtttgaatcccggactttgcatatattatgcatt |
48673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0238 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0238
Description:
Target: scaffold0238; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 25461 - 25415
Alignment:
| Q |
310 |
ggtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||| ||| || |||||| ||||||||||||||||||||||| |
|
|
| T |
25461 |
ggtggtgtctggggttcgaaccctggaccttgcatatattatgcatt |
25415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0143 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0143
Description:
Target: scaffold0143; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 318 - 356
Target Start/End: Complemental strand, 4530 - 4492
Alignment:
| Q |
318 |
ccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
4530 |
ccgggatttgaaccctggaccttgcataaattatgcatt |
4492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 326 - 356
Target Start/End: Original strand, 31927 - 31957
Alignment:
| Q |
326 |
tgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
31927 |
tgaaccccggaccttgcatatattatgcatt |
31957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 9474 - 9429
Alignment:
| Q |
311 |
gtggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||| |||||||||||| ||| |||||||||||| ||||||||| |
|
|
| T |
9474 |
gtggtggccgggatttgaatcccagaccttgcatattttatgcatt |
9429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0524 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0524
Description:
Target: scaffold0524; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 312 - 356
Target Start/End: Complemental strand, 1304 - 1260
Alignment:
| Q |
312 |
tggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
1304 |
tggtggccgggatttgaaccccggaccttatatagattatgcatt |
1260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0044 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 42337 - 42369
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
42337 |
tttgaaccccagaccttgcatatattatgcatt |
42369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 72778 - 72810
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
72778 |
tttgaaccctggaccttgcatatattatgcatt |
72810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 356
Target Start/End: Complemental strand, 99095 - 99063
Alignment:
| Q |
324 |
tttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
99095 |
tttgaaccccagaccttgcatatattatgcatt |
99063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 312 - 356
Target Start/End: Complemental strand, 185333 - 185289
Alignment:
| Q |
312 |
tggtgtccgggatttgaaccccggaccttgcatatattatgcatt |
356 |
Q |
| |
|
||||| ||||| ||||||||||||| ||||||||| ||||||||| |
|
|
| T |
185333 |
tggtgaccggggtttgaaccccggatcttgcatattttatgcatt |
185289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University