View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11655_low_49 (Length: 306)

Name: NF11655_low_49
Description: NF11655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11655_low_49
NF11655_low_49
[»] chr4 (1 HSPs)
chr4 (22-293)||(35202593-35202864)


Alignment Details
Target: chr4 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 22 - 293
Target Start/End: Original strand, 35202593 - 35202864
Alignment:
22 ccatagttttgatattgcttctacctcaaaccatatcaattctcttctttatggtaactcttcttgtcatgatgtgatgaactttccttttgcaacaagg 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35202593 ccatagttttgatattgcttctacctcaaaccatatcaattctcttctttatggtaactcttcttgtcatgatgtgatgaactttccttttgcaacaagg 35202692  T
122 ttcaattctacaagagtttcaagttcttcttctggttatgatcatcttcagcagcagcagcctcaggtgaatggtcttggattaggtttttcatctgggg 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35202693 ttcaattctacaagagtttcaagttcttcttctggttatgatcatcttcagcagcagcagcctcaggtgaatggtcttggattaggtttttcatctgggg 35202792  T
222 tagttaatcttaatcatcatgatgattacagaaatgggtttggttcaaataataacaactacagttccatct 293  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35202793 tagttaatcttaatcatcatgatgattacagaaatgggtttggttcaaataataacaactacagttccatct 35202864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University