View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11655_low_49 (Length: 306)
Name: NF11655_low_49
Description: NF11655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11655_low_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 22 - 293
Target Start/End: Original strand, 35202593 - 35202864
Alignment:
| Q |
22 |
ccatagttttgatattgcttctacctcaaaccatatcaattctcttctttatggtaactcttcttgtcatgatgtgatgaactttccttttgcaacaagg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35202593 |
ccatagttttgatattgcttctacctcaaaccatatcaattctcttctttatggtaactcttcttgtcatgatgtgatgaactttccttttgcaacaagg |
35202692 |
T |
 |
| Q |
122 |
ttcaattctacaagagtttcaagttcttcttctggttatgatcatcttcagcagcagcagcctcaggtgaatggtcttggattaggtttttcatctgggg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35202693 |
ttcaattctacaagagtttcaagttcttcttctggttatgatcatcttcagcagcagcagcctcaggtgaatggtcttggattaggtttttcatctgggg |
35202792 |
T |
 |
| Q |
222 |
tagttaatcttaatcatcatgatgattacagaaatgggtttggttcaaataataacaactacagttccatct |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35202793 |
tagttaatcttaatcatcatgatgattacagaaatgggtttggttcaaataataacaactacagttccatct |
35202864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University