View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11655_low_51 (Length: 301)
Name: NF11655_low_51
Description: NF11655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11655_low_51 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 22 - 301
Target Start/End: Original strand, 43408649 - 43408934
Alignment:
| Q |
22 |
gatccatcttttgctgatgcaggctgttgattttagaagtagtcacaacatgaatatcccacaagcagtaaaggtaa---gcaaacaatca---tcagat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
43408649 |
gatccatcttttgctgatgcaggctgttgattttagaagtagtcacaacatgaatatcccacaagcagtaaaggtaattagcaaacaatcatcatcagat |
43408748 |
T |
 |
| Q |
116 |
catagtactggatttgattaaatcaacaaaaactaaataaaattgtttctaaaaatgatatgataatgaataattaggtatttgaagagctatatgaagc |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408749 |
catagtactggatttgattagatcaacaaaaactatataaaattgtttctaaaaatgatatgataatgaataattaggtatttgaagagctatatgaagc |
43408848 |
T |
 |
| Q |
216 |
agccgtgaacgagataatggaagtgttggcttcagtgtgcaagacgcacaatttaccattagcactaacatgggctccttgcctac |
301 |
Q |
| |
|
||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408849 |
agcggtgaacgagataatggaagtgttggcgtcagtgtgcaagacgcacaatttaccattagcactaacatgggctccttgcctac |
43408934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University