View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11655_low_57 (Length: 265)
Name: NF11655_low_57
Description: NF11655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11655_low_57 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 7e-58; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 140 - 253
Target Start/End: Complemental strand, 25428044 - 25427931
Alignment:
| Q |
140 |
accaacaatgccttcaattgcatcttccaaacgcagattcagatctcccgccacacccatcccgaccaccaccacttctcctcccacccgcaaatccccc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25428044 |
accaacaatgccttcaattgcatcttccaaacgcagattcagatctcccgccacacccatcccgaccaccaccacttctcctcccacccgcaaatccccc |
25427945 |
T |
 |
| Q |
240 |
cgccgttgcatctc |
253 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
25427944 |
cgccgttgcatctc |
25427931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 50
Target Start/End: Complemental strand, 25428180 - 25428148
Alignment:
| Q |
18 |
gttttcccgcttaacacaccaactacaaatccc |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
25428180 |
gttttcccgcttaacacaccaactacaaatccc |
25428148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University