View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11655_low_58 (Length: 264)
Name: NF11655_low_58
Description: NF11655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11655_low_58 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 41950938 - 41951194
Alignment:
| Q |
1 |
ggaaagaattgcaatttcttttacgtggtgcagaataatgcaagctgtgcaatttctttgtggaattttgaccattccaaaaacaatgtactgcgaaagt |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41950938 |
ggaaagaaatgcaatttcttttacgtggtgcagaataatgcaagctgtgcaatttctttgtggaattttgaccattccaaaaacaatgtactgcgaaagt |
41951037 |
T |
|
| Q |
101 |
ctagaatattatgagaatattagaagaaaggctatgggccatgtacagtgtacgttagtaccaacttgccaagtagtaggtctttctttattggacaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41951038 |
ctagaatattatgagaatattagaag-aaggctatgggccatgtacagtgtacg-tagtaccaacttgccaagtagtaggtctttctttattggacaaat |
41951135 |
T |
|
| Q |
201 |
gtctcttaatcaacttgttcacaccttcctaggtcatgcctgctgctggaccctatgct |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41951136 |
gtctcttaatcaacttgttcacaccttcctaggtcatgcctgctgctggaccctatgct |
41951194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University