View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11655_low_68 (Length: 244)
Name: NF11655_low_68
Description: NF11655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11655_low_68 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 41 - 226
Target Start/End: Complemental strand, 28103308 - 28103113
Alignment:
| Q |
41 |
cattcttatcaccgacatcacaccacatgtacttccaaaccaattcagttttgaagaactattggaaaa----------ttcaaatcgctcaaattgttt |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28103308 |
cattcttatcaccgacatcacaccacatgtacttccaaaccaagtcagttttgaagaactattggaaaacgtgaccaaattcaaatcgctcaaattgttt |
28103209 |
T |
|
| Q |
131 |
gattccagcgaagacgaagacagatatcttggtatgcagtgcaattgtgacttcaacaagtgcatgtttcttgaatcttatcgtctctatcatgca |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28103208 |
gattccagcgaagacgaagacagatatcttggtatgcagtgcaattgtgacttcaacaagtgcatgtttcttgaatcttatcgtctctatcatgca |
28103113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 211
Target Start/End: Original strand, 28087754 - 28087805
Alignment:
| Q |
160 |
tggtatgcagtgcaattgtgacttcaacaagtgcatgtttcttgaatcttat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| | |||| |||||||| |
|
|
| T |
28087754 |
tggtatgcagtgcaattgtgacttcaacaactgcatatgtcttcaatcttat |
28087805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 160 - 214
Target Start/End: Original strand, 28087573 - 28087627
Alignment:
| Q |
160 |
tggtatgcagtgcaattgtgacttcaacaagtgcatgtttcttgaatcttatcgt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| | |||| ||||||||||| |
|
|
| T |
28087573 |
tggtatgcagtgcaattgtgacttcaacaactgcacatgtcttaaatcttatcgt |
28087627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 211
Target Start/End: Complemental strand, 28105839 - 28105788
Alignment:
| Q |
160 |
tggtatgcagtgcaattgtgacttcaacaagtgcatgtttcttgaatcttat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| | |||| |||||||| |
|
|
| T |
28105839 |
tggtatgcagtgcaattgtgacttcaacaactgcacatgtcttcaatcttat |
28105788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 211
Target Start/End: Complemental strand, 28106008 - 28105957
Alignment:
| Q |
160 |
tggtatgcagtgcaattgtgacttcaacaagtgcatgtttcttgaatcttat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| | |||| |||||||| |
|
|
| T |
28106008 |
tggtatgcagtgcaattgtgacttcaacaactgcacatgtcttaaatcttat |
28105957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University