View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11655_low_70 (Length: 241)
Name: NF11655_low_70
Description: NF11655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11655_low_70 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 18866012 - 18866207
Alignment:
| Q |
1 |
ttagattcttgttatgtgtttaatta---tttgttaagggtgaactgattgtgatctatgtagcaccgacacattaattgaacacatttattgatgtgtt |
97 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| ||||| |
|
|
| T |
18866012 |
ttagattcttgttatgtgtttaattattatttgttaagggtgaactgattgtgatctatgtagcaccgacacattaattgaataaatttattgacgtgtt |
18866111 |
T |
 |
| Q |
98 |
caatgggtttatgtttaacaacacgccaacacagtgtcgtgtcagtcacaaaagtgacctttcgttgcgatacgaaaacgagttcatatattagtg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18866112 |
caatgggtttatgtttaacaacacgccaacacagtgtcgtgtcggtcacaaaagtgacctttcgttgcgatacgaaaatgagttcatatattagtg |
18866207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University