View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11655_low_84 (Length: 213)
Name: NF11655_low_84
Description: NF11655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11655_low_84 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 39 - 194
Target Start/End: Complemental strand, 47099830 - 47099675
Alignment:
| Q |
39 |
cttgtgtgtccaagatgtgtgtttcatcaaggattatgtttagctaaaaatcaaggtgttttgaaactagaagtgcaaattgacccagctgtgattgtta |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47099830 |
cttgtgtgtccaagatgtgtgtttcatcaaggattatgtttagctaaaaatcaaggtgttttgaaactagaagtgcaaattgacccagctgtgattgtta |
47099731 |
T |
|
| Q |
139 |
gaagagaagggagtacagcaggttggcctctcataaacaaaattaaggctatcctt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47099730 |
gaagagaagggagtacagcaggttggcctctcataaacaaaattaaggctatcctt |
47099675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 2 - 46
Target Start/End: Complemental strand, 47100228 - 47100185
Alignment:
| Q |
2 |
gagttgacgggactatatcaaggtgtttccataagcacttgtgtg |
46 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47100228 |
gagttgacgggactatatcaaggtgttt-cataagcacttgtgtg |
47100185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University