View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11655_low_86 (Length: 203)

Name: NF11655_low_86
Description: NF11655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11655_low_86
NF11655_low_86
[»] chr3 (1 HSPs)
chr3 (15-183)||(48236567-48236735)
[»] chr1 (1 HSPs)
chr1 (140-183)||(3685864-3685907)


Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 15 - 183
Target Start/End: Complemental strand, 48236735 - 48236567
Alignment:
15 gagatgaaggctaggaaagaggcagaagagaggaataaagtattgaatgcattggctcaaaatgataatcgatatagaaaatacactatgatggagattg 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48236735 gagatgaaggctaggaaagaggcagaagagaggaataaagtattgaatgcattggctcaaaatgataatcgatatagaaaatacactatgatggagattg 48236636  T
115 aagttgctaccgagagattctcaccatcaaagaaactaggtgaaggtggatatggacctgtgtttaaag 183  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
48236635 aagttgctaccgagagattctcaccatcaaagaaactaggtgaaggtggatacggacctgtgtttaaag 48236567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 140 - 183
Target Start/End: Original strand, 3685864 - 3685907
Alignment:
140 atcaaagaaactaggtgaaggtggatatggacctgtgtttaaag 183  Q
    ||||| |||| |||||||||||||||||||||||||||||||||    
3685864 atcaatgaaaataggtgaaggtggatatggacctgtgtttaaag 3685907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University