View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11656_high_16 (Length: 288)
Name: NF11656_high_16
Description: NF11656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11656_high_16 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 17 - 288
Target Start/End: Complemental strand, 2004868 - 2004594
Alignment:
| Q |
17 |
atctatctcatcaaagatttggtactgcttgcgagtatgtttgtagacggaatccataattatgatcatatatacttatttggcgcattgaaagtgattt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2004868 |
atctatctcatcaaagatttggtactgcttgcgagtatgtttgtagacggaatccataattatgatcatatatacttatttggcgcattgaaagtgattt |
2004769 |
T |
|
| Q |
117 |
attgatcattcactctcattgtcagtttactcgtgcacacaccagctcttctagtggcaatgaagg---gttcaatcggtcagcttcaaattttaaaatg |
213 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |||||||||| | ||||||||||||||||| |
|
|
| T |
2004768 |
attgatcattcactctcattgtgagtttactcgtgcacacactagctcttctagtggcaatgaaggatctttcaatcggttaacttcaaattttaaaatg |
2004669 |
T |
|
| Q |
214 |
ataaagtttgttggaaacacaaacttatcccctcgcacaaaaacatcatcagtccttctttctggctgcttttat |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2004668 |
ataaagtttgttggaaacacaaacttatccccttgcacaaaaacatcatcaatccttctttctggctgcttttat |
2004594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University