View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11656_high_18 (Length: 267)
Name: NF11656_high_18
Description: NF11656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11656_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 16 - 248
Target Start/End: Complemental strand, 47172331 - 47172099
Alignment:
| Q |
16 |
agagaagaatcacttgcatatctcatagtactattatatataattcatgaatgaagttgagttgattcacctcacttcaaaaccatgatttctttttata |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47172331 |
agagaagaatcacttgcatatctcatagtactattatatataattcatgaatgaagttgagttgattcacctcacttcaaaaccatgatttcttcttata |
47172232 |
T |
 |
| Q |
116 |
gaagagtggtctagtggccacacactgcggaccaataaattgaatcaacatattataatgaggaaagtttgtatgagtttcagaaaccccctcttatgtt |
215 |
Q |
| |
|
|||||||||||||||||||||| || || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47172231 |
gaagagtggtctagtggccacataccgcagaccaataaattgaatcaacatattataatgaggaaagtttgtatgagtttcagaaaccccctcttatgtt |
47172132 |
T |
 |
| Q |
216 |
gtattccctttctttctccttccaccatccccc |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
47172131 |
gtattccctttctttctccttccaccatccccc |
47172099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University