View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11656_high_28 (Length: 233)
Name: NF11656_high_28
Description: NF11656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11656_high_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 126 - 217
Target Start/End: Original strand, 13467871 - 13467962
Alignment:
| Q |
126 |
atccaaaacaacaaaatccaagtagtcacttaacctatgttcatgtatgtcccttgacaattgctattttcaaaccctatcagtcagttcat |
217 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13467871 |
atccaaaacaacaaaatccaactagtgacttaacctatgttcatgtatgtcccttgacaattgctattttcaaaccatatcagtcagttcat |
13467962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 179 - 216
Target Start/End: Original strand, 13472021 - 13472058
Alignment:
| Q |
179 |
ttgacaattgctattttcaaaccctatcagtcagttca |
216 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13472021 |
ttgacaattgctattttcaaatcctatcagtcagttca |
13472058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University