View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11656_high_30 (Length: 226)

Name: NF11656_high_30
Description: NF11656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11656_high_30
NF11656_high_30
[»] chr5 (1 HSPs)
chr5 (152-213)||(27357772-27357833)


Alignment Details
Target: chr5 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 152 - 213
Target Start/End: Complemental strand, 27357833 - 27357772
Alignment:
152 aaaaatcagtactactcaaaccttatttccaagacattatcttgatttcatcaaccacctct 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27357833 aaaaatcagtactactcaaaccttatttccaagacattatcttgatttcatcaaccacctct 27357772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University