View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11656_low_19 (Length: 264)
Name: NF11656_low_19
Description: NF11656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11656_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 82 - 258
Target Start/End: Complemental strand, 50876307 - 50876132
Alignment:
| Q |
82 |
taaaattaataggacggtgtaagatccaatacgttgttgaacatgtagatgtgtagttttgctgtnnnnnnnnnncactgttctcaaattatatcaattg |
181 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
50876307 |
taaaattaataggacggtgtaagacccaatacgttgttgaacatgta-atgtgtagttttgctgtaaaaaaaaaacattgttctcaaattatatcaattg |
50876209 |
T |
|
| Q |
182 |
aatgttacaaactgttagtatatggtatgtattaatttaactgtgatggaagagcaaaccttggcaatctgtgctgc |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50876208 |
aatgttacaaactgttagtatatggtatgtattaatttaactgtgatggaagagcaaaccttggcaatctgtgctgc |
50876132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University