View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11656_low_22 (Length: 248)
Name: NF11656_low_22
Description: NF11656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11656_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 19 - 242
Target Start/End: Complemental strand, 11940041 - 11939818
Alignment:
| Q |
19 |
gtgactgttgagatttgcaatggactatcattggcttggaggtgtgtcattgctgtgatttacagtttctttaatagggagcatttgagaggttttagtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11940041 |
gtgactgttgagatttgcaatggactatcattggcttggaggtgtgtcattgctgtgatttacagtttctttaataaggagcatttgagaggttttagtt |
11939942 |
T |
|
| Q |
119 |
agagaaattggttctttctcagaaagggagctatctattagtttgattttatttccatcttgtaaggagcttgttccactcaatattatcatgttatatt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11939941 |
agagaaattggttctttctcagaaagggagctatctattagtttggttttatttccatcttgtaaggagcttgttccactcaatattatcatgttatatt |
11939842 |
T |
|
| Q |
219 |
tatgttattttctgtctctgctcc |
242 |
Q |
| |
|
||||||||||||||| |||||||| |
|
|
| T |
11939841 |
tatgttattttctgtttctgctcc |
11939818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 84 - 242
Target Start/End: Original strand, 8552946 - 8553104
Alignment:
| Q |
84 |
tttctttaatagggagcatttgagaggttttagttagagaaattggttctttctcagaaagggagctatctattagtttgattttatttccatcttgtaa |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |||||||||||||||||||||||||||| |||||| ||| |
|
|
| T |
8552946 |
tttctttaatagggagcatttgagaggttttagttagagaagttggttctttctccgaaatggagctatctattagtttgattttatttgcatcttctaa |
8553045 |
T |
|
| Q |
184 |
ggagcttgttccactcaatattatcatgttatatttatgttattttctgtctctgctcc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||||| |||||||| |
|
|
| T |
8553046 |
atagcttgttccactcaatattatcatgttctatttctgttattttctgtttctgctcc |
8553104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University