View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11656_low_24 (Length: 240)
Name: NF11656_low_24
Description: NF11656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11656_low_24 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 30769032 - 30769254
Alignment:
| Q |
18 |
atttcctgctcctaagaagccccaggaacgtgttgatcttattgcatatctgaaataggatgcttgaaaatgattgaagttatgtatcatatgtagtata |
117 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30769032 |
atttcctgctcttaagaagccccaggaacgtgttgatcttattgcatatctgaaataggatgcttgaaaatgattgaagttatgtatcatatgtagtata |
30769131 |
T |
|
| Q |
118 |
cttttggagttctggatatttaatcatctggaaatttgatcttgcgttgtaattagcaatttagcactctatattggcaaataaagcagacattataagt |
217 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30769132 |
cttttggagttctggatatttaattatctggaaatttgatcttgcgttgtaattagcaatttagcactctatattggcaaataaagcagacattataagt |
30769231 |
T |
|
| Q |
218 |
ttccaatgttattttgttccttt |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
30769232 |
ttccaatgttattttgttccttt |
30769254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 72
Target Start/End: Original strand, 30772892 - 30772945
Alignment:
| Q |
19 |
tttcctgctcctaagaagccccaggaacgtgttgatcttattgcatatctgaaa |
72 |
Q |
| |
|
||||||| || ||||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
30772892 |
tttcctggtcttaagaagcctcaagaacgtgctgatcttattgcatatctgaaa |
30772945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University