View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11656_low_28 (Length: 233)

Name: NF11656_low_28
Description: NF11656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11656_low_28
NF11656_low_28
[»] chr8 (2 HSPs)
chr8 (126-217)||(13467871-13467962)
chr8 (179-216)||(13472021-13472058)


Alignment Details
Target: chr8 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 126 - 217
Target Start/End: Original strand, 13467871 - 13467962
Alignment:
126 atccaaaacaacaaaatccaagtagtcacttaacctatgttcatgtatgtcccttgacaattgctattttcaaaccctatcagtcagttcat 217  Q
    ||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
13467871 atccaaaacaacaaaatccaactagtgacttaacctatgttcatgtatgtcccttgacaattgctattttcaaaccatatcagtcagttcat 13467962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 179 - 216
Target Start/End: Original strand, 13472021 - 13472058
Alignment:
179 ttgacaattgctattttcaaaccctatcagtcagttca 216  Q
    ||||||||||||||||||||| ||||||||||||||||    
13472021 ttgacaattgctattttcaaatcctatcagtcagttca 13472058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University