View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11656_low_29 (Length: 229)
Name: NF11656_low_29
Description: NF11656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11656_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 6 - 82
Target Start/End: Complemental strand, 27357908 - 27357832
Alignment:
| Q |
6 |
aggttttgtctcctttatatatagtctatataagtcaattaccagcaaattctatggtgcatttgataactttgcaa |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27357908 |
aggttttgtctcctttatatatagtctatataagtcaatcaccagcaaattctatggtgcatttgataactttgcaa |
27357832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 168 - 218
Target Start/End: Complemental strand, 26544239 - 26544189
Alignment:
| Q |
168 |
aaatgaatccttctttgtaacttcatcatgcaaaatgtgattgcaagtagt |
218 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26544239 |
aaatgaatcctactttgtgacttcatcatgcaaaatgtgattgcaagtagt |
26544189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University