View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11658_high_31 (Length: 253)
Name: NF11658_high_31
Description: NF11658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11658_high_31 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 18 - 253
Target Start/End: Original strand, 39264103 - 39264338
Alignment:
| Q |
18 |
gaatttgctattgattccattgatatcattcaacaacaacaacaatggcaggtggaaaccgaaacaccaaggcgattgcaagggacaacgcaacaaaaga |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39264103 |
gaatttgctattgattccattgatgtcattcaacaacaacaacaatggcaggtggaaaccgaaacaccaaggcgattgcaagggacaacgcaacaaaaga |
39264202 |
T |
|
| Q |
118 |
aaggcggagatgatgaacaacaaggtgacgataaaagtggtaagttcactttgcaacagctctttcaacaatctaaagtaattgatgaagatatcatcaa |
217 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39264203 |
aaggcagagatgatgaacaacaaggtgacgataaaagtggtaagttcactttgcaacagctctttcaacaatctaaagtaattgatgaagatatcatcaa |
39264302 |
T |
|
| Q |
218 |
taagactggaactgggatggatttctcatatgattt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
39264303 |
taagactggaactgggatggatttctcatatgattt |
39264338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University