View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11658_high_32 (Length: 249)
Name: NF11658_high_32
Description: NF11658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11658_high_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 29611209 - 29610971
Alignment:
| Q |
1 |
catgcaacaatccatatgctatgacaaaaaccgggtttggaccatatcggtttcttggggctatacggttcaaatatttcgcggcattttctcggcacga |
100 |
Q |
| |
|
|||||||||||| |||||||||| ||||||| ||||||||||| |||||||||||||||| ||| ||||||||||||||||||| |||||||| |||||| |
|
|
| T |
29611209 |
catgcaacaatctatatgctatgtcaaaaactgggtttggaccgtatcggtttcttggggttatgcggttcaaatatttcgcggaattttctcagcacga |
29611110 |
T |
 |
| Q |
101 |
gatattgaaatgcccgcgagaactttcttgaattggtatcgtcgagttgattataatggatttccatttaacacaagaccttttagtcgcaatgcttgtc |
200 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
29611109 |
gatattgaaatgcccgcacgaactttcttaaattggtatcgtcgagttgattataatgggtttccattcaatacaagaccttttagtcgcaatgcttgtc |
29611010 |
T |
 |
| Q |
201 |
aaaaaccgtttgtttttcatttgtctaatactacctatg |
239 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29611009 |
aaaaaccgtttgtttttcatttgtttaatactacctatg |
29610971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 5 - 93
Target Start/End: Original strand, 11094825 - 11094913
Alignment:
| Q |
5 |
caacaatccatatgctatgacaaaaaccgggtttggaccatatcggtttcttggggctatacggttcaaatatttcgcggcattttctc |
93 |
Q |
| |
|
||||||||||| ||||||||||||| ||| |||||||||||| || || ||||||||| |||||||||||| ||| || |||||||| |
|
|
| T |
11094825 |
caacaatccatttgctatgacaaaacacggacttggaccatatctgtgtcatggggctatgcggttcaaatatatcggggaattttctc |
11094913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University