View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11658_high_33 (Length: 243)
Name: NF11658_high_33
Description: NF11658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11658_high_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 69; Significance: 4e-31; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 3 - 83
Target Start/End: Complemental strand, 47022947 - 47022867
Alignment:
| Q |
3 |
tatctcccaaacaaacaccccattggagtaacatttgtattatgtggtatttgctgattctaatgaaactcttcataatct |
83 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47022947 |
tatctcccaaacaaacaccccgttagagtaacatttgtagtatgtggtatttgctgattctaatgaaactcttcataatct |
47022867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 166 - 218
Target Start/End: Complemental strand, 47022350 - 47022298
Alignment:
| Q |
166 |
tcttcaaaatgaatgcgaaactaagaaatcaaagttaaattcttccaataata |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47022350 |
tcttcaaaatgaatgcgaaactaagaaatcaaagttaaattcttccaataata |
47022298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 72 - 150
Target Start/End: Complemental strand, 47022440 - 47022368
Alignment:
| Q |
72 |
tcttcataatctgatattggtatgtaagtgtaagtcacatgttttacatatagnnnnnnnnaacttcattcatacttgt |
150 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47022440 |
tcttcataatctgatattggtatgt------aagtcacatgttttacatatagttttttttaacttcattcatacttgt |
47022368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University