View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11658_high_33 (Length: 243)

Name: NF11658_high_33
Description: NF11658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11658_high_33
NF11658_high_33
[»] chr7 (3 HSPs)
chr7 (3-83)||(47022867-47022947)
chr7 (166-218)||(47022298-47022350)
chr7 (72-150)||(47022368-47022440)


Alignment Details
Target: chr7 (Bit Score: 69; Significance: 4e-31; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 3 - 83
Target Start/End: Complemental strand, 47022947 - 47022867
Alignment:
3 tatctcccaaacaaacaccccattggagtaacatttgtattatgtggtatttgctgattctaatgaaactcttcataatct 83  Q
    ||||||||||||||||||||| || |||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
47022947 tatctcccaaacaaacaccccgttagagtaacatttgtagtatgtggtatttgctgattctaatgaaactcttcataatct 47022867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 166 - 218
Target Start/End: Complemental strand, 47022350 - 47022298
Alignment:
166 tcttcaaaatgaatgcgaaactaagaaatcaaagttaaattcttccaataata 218  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
47022350 tcttcaaaatgaatgcgaaactaagaaatcaaagttaaattcttccaataata 47022298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 72 - 150
Target Start/End: Complemental strand, 47022440 - 47022368
Alignment:
72 tcttcataatctgatattggtatgtaagtgtaagtcacatgttttacatatagnnnnnnnnaacttcattcatacttgt 150  Q
    |||||||||||||||||||||||||      ||||||||||||||||||||||        ||||||||||||||||||    
47022440 tcttcataatctgatattggtatgt------aagtcacatgttttacatatagttttttttaacttcattcatacttgt 47022368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University