View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11658_high_8 (Length: 479)
Name: NF11658_high_8
Description: NF11658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11658_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 349; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 95 - 464
Target Start/End: Complemental strand, 38455245 - 38454880
Alignment:
| Q |
95 |
gatggaacaaacgcaccattgatgttgcaccctatcattcattcattcattctccacgttgggatgttagcaaaagaatgtcaaacatataggccaaggc |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38455245 |
gatggaacaaacgcaccattgatgttgcaccctatcattcattcattc----tccacgttgggatgttagcaaaagaatgtcaaacatataggccaaggc |
38455150 |
T |
|
| Q |
195 |
caagggcaatttgggtatgaatatcgaattattggtacaatttttgatccaagatcccttgaataatgtgctgagatagatatattgatccacatatctg |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38455149 |
caagggcaatttgggtatgaatatcgaattattggtacaatttgtgatccaagatcccttgaataatgtgctgagatagatatattgatccacatatctg |
38455050 |
T |
|
| Q |
295 |
gcacatgtctttgccttgtgtgatacaagttcaagattcagttgtccctttccttatgcctcccaccatgtttggcacatacctttaccgtgtgacccaa |
394 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38455049 |
gcacatgtctttgccttgtgtgatacaagttcaagattcagttgtccctttccttatgcctcccaccatgtttggcacatacctttaccgtgtgacccaa |
38454950 |
T |
|
| Q |
395 |
gtttgcgatttctttgtcccatttttatgcccacaacaacgttcaggaaattatggagacgctgtagctg |
464 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38454949 |
gtttgcgatttctttgtcccatttttatgcccacaacaacgttcaggaaattatggagacgctgtagctg |
38454880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University