View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11658_low_24 (Length: 315)
Name: NF11658_low_24
Description: NF11658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11658_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 94 - 301
Target Start/End: Original strand, 34343632 - 34343839
Alignment:
| Q |
94 |
gttatgttggattgaattatataaagtagtagcagcagctgataggacagtccatgcaacaaaaataggtagttattgaaagaaatcttctgaaacacaa |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
34343632 |
gttatgttggattgaattatataaagtagtagcagcagctgataggacagtccatgcaacaaaaataggtagtcattgaaagaaatcttctgaaacacaa |
34343731 |
T |
|
| Q |
194 |
tggtttccattctttgttgtgaaagaaatccagtatcatgtgattcacagagttcttttttcgtaaattttccactttggtcccattttcttctcattag |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34343732 |
tggtttccattctttgttgtgaaagaaatccagtatcatgtgattcacagagttcttttttcgtaaattttccactttggtcccattttcttctcattag |
34343831 |
T |
|
| Q |
294 |
tttgtgtc |
301 |
Q |
| |
|
|||||||| |
|
|
| T |
34343832 |
tttgtgtc |
34343839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University