View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11658_low_31 (Length: 253)

Name: NF11658_low_31
Description: NF11658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11658_low_31
NF11658_low_31
[»] chr8 (1 HSPs)
chr8 (18-253)||(39264103-39264338)


Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 18 - 253
Target Start/End: Original strand, 39264103 - 39264338
Alignment:
18 gaatttgctattgattccattgatatcattcaacaacaacaacaatggcaggtggaaaccgaaacaccaaggcgattgcaagggacaacgcaacaaaaga 117  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39264103 gaatttgctattgattccattgatgtcattcaacaacaacaacaatggcaggtggaaaccgaaacaccaaggcgattgcaagggacaacgcaacaaaaga 39264202  T
118 aaggcggagatgatgaacaacaaggtgacgataaaagtggtaagttcactttgcaacagctctttcaacaatctaaagtaattgatgaagatatcatcaa 217  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39264203 aaggcagagatgatgaacaacaaggtgacgataaaagtggtaagttcactttgcaacagctctttcaacaatctaaagtaattgatgaagatatcatcaa 39264302  T
218 taagactggaactgggatggatttctcatatgattt 253  Q
    ||||||||||||||||||||||||||||||||||||    
39264303 taagactggaactgggatggatttctcatatgattt 39264338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University