View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11659_high_6 (Length: 284)
Name: NF11659_high_6
Description: NF11659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11659_high_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 20 - 276
Target Start/End: Complemental strand, 31520102 - 31519846
Alignment:
| Q |
20 |
tgaaccaatctccaacacaatcagaatcatctgagcctttgaatgagagaaaattattcgagtgtcaatattgttgtagagaatttgcaaattcacaagc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31520102 |
tgaaccaatctccaacacaatcagaatcatctgagcctttgaatgggagaaaattatacgagtgtcaatattgttgtagagaatttgcaaattcacaagc |
31520003 |
T |
|
| Q |
120 |
cttaggaggacaccaaaatgcacacaagaaagaaaggcaacttttgaaacgtgctcaaatgcaagcagctcgtgcctttgttccttcacatttccataac |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31520002 |
cttaggaggacaccaaaatgcacacaagaaagagaggcaacttttgaaacgtgctcaaatgcaagcagctcgtgcctttgttccttcacatttccataac |
31519903 |
T |
|
| Q |
220 |
agattcatctcatcaccgcagtggctgccacaacaaaatcatttcctcgcctatgct |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31519902 |
agattcatctcatcaccgcagtggctgccacaacaaaatcatttcctcgccaatgct |
31519846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 79 - 155
Target Start/End: Complemental strand, 15575116 - 15575040
Alignment:
| Q |
79 |
gagtgtcaatattgttgtagagaatttgcaaattcacaagccttaggaggacaccaaaatgcacacaagaaagaaag |
155 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||| |||||||| || ||||||||||||||||||||||| |
|
|
| T |
15575116 |
gagtgtcaatattgtttcaaagaatttgcaaattcacaagcattaggaggccatcaaaatgcacacaagaaagaaag |
15575040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 78 - 152
Target Start/End: Complemental strand, 22863319 - 22863245
Alignment:
| Q |
78 |
cgagtgtcaatattgttgtagagaatttgcaaattcacaagccttaggaggacaccaaaatgcacacaagaaaga |
152 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| || |||||| |||| ||||||||||| |||||||| ||||| |
|
|
| T |
22863319 |
cgagtgtcaatattgttgtcgagaatttgcaaactcgcaagccctaggtggacaccaaaacgcacacaaaaaaga |
22863245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 78 - 153
Target Start/End: Original strand, 49774318 - 49774393
Alignment:
| Q |
78 |
cgagtgtcaatattgttgtagagaatttgcaaattcacaagccttaggaggacaccaaaatgcacacaagaaagaa |
153 |
Q |
| |
|
|||||| ||||||||||| ||||| |||||||||||||||||| | || ||||||||||| || ||||| |||||| |
|
|
| T |
49774318 |
cgagtgccaatattgttgcagagagtttgcaaattcacaagcccttggcggacaccaaaacgctcacaaaaaagaa |
49774393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 109 - 146
Target Start/End: Original strand, 39663801 - 39663838
Alignment:
| Q |
109 |
aattcacaagccttaggaggacaccaaaatgcacacaa |
146 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
39663801 |
aattcacaagccttagggggtcaccaaaatgcacacaa |
39663838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University