View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11659_low_10 (Length: 213)
Name: NF11659_low_10
Description: NF11659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11659_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 2e-32; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 13 - 197
Target Start/End: Complemental strand, 10123792 - 10123610
Alignment:
| Q |
13 |
gagaagaataaatcaggtagttcagtgagtttgttagggttatgcctcaaaacaataannnnnnnngctattaaatgattagctaaaaaaaggtttgttt |
112 |
Q |
| |
|
||||| || ||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
10123792 |
gagaaaaacaaatcaggtagttcaatgagtttgttagggttatgcctcaaaacaataa-tttttttgctattaaatgattagct-aaaaaaggtttgttt |
10123695 |
T |
 |
| Q |
113 |
gttatgtgtcnnnnnnnnnnnnnnngtttgttaaaattttgagtggaaagaggaaaagtttgttgtaattaatcagccagaaaaa |
197 |
Q |
| |
|
||||||||| |||||||| ||||||| ||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
10123694 |
gttatgtgtaaaaaaaaaaaaaatagtttgttacaattttgcgtggaaagaggtaaagtttgttgtaattaatcagcccgaaaaa |
10123610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University