View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1165_low_10 (Length: 395)
Name: NF1165_low_10
Description: NF1165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1165_low_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 4e-60; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 263 - 384
Target Start/End: Complemental strand, 14885975 - 14885854
Alignment:
| Q |
263 |
ctttgtattattgagtgattttagaggccttaatgcgagcactttaatttcaaacatatcatgggacctgggatagaattttctcaactagtaatgtctt |
362 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14885975 |
ctttgtattattgagtgattttagaggccttaatgcgagcactttaatttcaaacatatcatgggacctgggatagaattttctcaaatagtaatgtctt |
14885876 |
T |
 |
| Q |
363 |
cagaggccttttgaatcttcat |
384 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
14885875 |
cagaggccttttgaatcttcat |
14885854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 14886101 - 14885983
Alignment:
| Q |
1 |
tgcatttatggctaacgtttgtgattcttatgattcatgatcaagatgattccctaaggctagctaagaagtttctccattgtagtatagggacaaatcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14886101 |
tgcatttatggctaacgtttgtgattcttgtgattcatgatcaagatgattccctaaggctagctaagaagtttctccattgtagtatagggacaaatcc |
14886002 |
T |
 |
| Q |
101 |
tttctagtacctgagcttt |
119 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
14886001 |
tttctagtacctgagcttt |
14885983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 324 - 384
Target Start/End: Original strand, 24320389 - 24320449
Alignment:
| Q |
324 |
tgggacctgggatagaattttctcaactagtaatgtcttcagaggccttttgaatcttcat |
384 |
Q |
| |
|
|||||| ||||||||||||||| ||||| |||||||||||| | | | |||||||||||| |
|
|
| T |
24320389 |
tgggacttgggatagaattttcccaacttctaatgtcttcagtgacatcttgaatcttcat |
24320449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 16714440 - 16714490
Alignment:
| Q |
334 |
gatagaattttctcaactagtaatgtcttcagaggccttttgaatcttcat |
384 |
Q |
| |
|
|||| ||||| ||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
16714440 |
gataaaatttcctcaacttgtaatgtcttcagaggcctcttgaatcttcat |
16714490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 331 - 384
Target Start/End: Original strand, 12865001 - 12865054
Alignment:
| Q |
331 |
tgggatagaattttctcaactagtaatgtcttcagaggccttttgaatcttcat |
384 |
Q |
| |
|
||||||| ||||| ||||||| ||||||||||||||| ||| |||||||||||| |
|
|
| T |
12865001 |
tgggataaaatttcctcaacttgtaatgtcttcagagacctcttgaatcttcat |
12865054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 331 - 384
Target Start/End: Complemental strand, 29985471 - 29985418
Alignment:
| Q |
331 |
tgggatagaattttctcaactagtaatgtcttcagaggccttttgaatcttcat |
384 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||| ||| |||||||||||| |
|
|
| T |
29985471 |
tgggatagaatttttccaacttgtaatgtcttcagagacctcttgaatcttcat |
29985418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 20103190 - 20103145
Alignment:
| Q |
339 |
aattttctcaactagtaatgtcttcagaggccttttgaatcttcat |
384 |
Q |
| |
|
||||||||||||| |||||||| |||||||||| ||||||| |||| |
|
|
| T |
20103190 |
aattttctcaacttgtaatgtcatcagaggcctcttgaatcctcat |
20103145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University